The dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the virus infects in swine do not express the dUTPase protein. Which of the following is a reasonable explanation for the role of the dUTPase in the virus lifecycle? Explain your choice in 25 words or less.The dUTPase is necessary to remove dUTP from the viral genome, as uracil should not be present in DNAThe dUTPase is necessary to remove dUTP from the viral genome, as uridine cannot correctly base pair with adenine-containing basesThe dUTPase is necessary to remove dUTP from the viral genome, as uridine has the wrong sugar component for building DNAMore than one of the above answers is correctNone of the above answers is correct

The African swine fever (ASF) virus is DNA virus, having double stranded DNA as it's genetic…

The dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the virus infects in swine do not express the dUTPase protein. Which of the following is a reasonable explanation for the role of the dUTPase in the virus lifecycle? Explain your choice in 25 words or less.

The dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the virus infects in swine do not express the dUTPase protein. Which of the following is a reasonable explanation for the role of the dUTPase in the virus lifecycle? Explain your choice in 25 words or less.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Emtricitabine (2',3'-dideoxy-5-fluoro-3'-thiacytidine, abbreviated as FTC) is a nucleoside analog that is used to treat HIV. It works by reversibly binding to HIV reverse transcriptase (HIV RT) and by doing so, inhibits the virus from replicating itself. In an experiment, FTC and purified HIV RT are mixed at low concentrations and allowed to reach equilibrium. The concentrations measured are [FTC] = 10 nM, [HIV RT] = 37.5 nM, and [HIV RT-FTC] = 2.5 µM, for the equilibrium FTC + HIV RT= HIV RT-FTC. What is the Kd in nM?
Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
given below is a small slice of a large sequence of protein taken from ORF1a polyprotein of Severe acute respiratory syndrome coronavirus 2 (isolate: wuhan-1). Convert the following sequence into protein strand using one letter code: 5'-ACCAACCAACTTTCGATCTCTTGTAGATCT-3'
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & III
AZT (3'-azido-2',3'-dideoxythymidine) is a drug for HIV infection that gets incorporated into growing viral DNA and blocks the activity of: reverse transcriptase Integrase DNA ligase DNA polymerase β (beta).
Tenofovir, an analog of adenosine monophosphate, is a nucleoside reverse transcriptase inhibitor used to treat HIV infection. Atazanavir, also used to treat HIV infection, is a protease inhibitor. Approximately 1 in 1,000 virus particles carries a mutation that confers resistance against any given anti-HIV drug. If there are 1010 virus particles circulating in a patient, roughly how many of them would be resistant to both tenofovir and atazanavir? - 104 - 106 - 107 - 5 x 107 - 1010
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3' 3'-TTGAGGCTGATGCGAGGTAAAGCTCGT- 5'
You are treating a patient suffering with wound botulism in which Clostridium botulinum grows in a wound and makes a protein exotoxin, botulinum toxin. In addition to surgery to clean the wound and providing botulinum antitoxin, you wish to give the patient antibiotics to stop the protein toxin synthesis immediately. Which of the following antibiotics would you NOT give your patient if you wished to immediately stop bacterial translation? (best answer) O macrolides, e.g. erythromycin O trimethoprim plus sulfa drugs e.g. sulfamethoxazole O chloroamphenicol tetracylines aminoglycosides e.g. gentamicin
Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letter