Answered: Explain how transcription and…

Science

Biology

Explain how transcription and translation may or may not be altered by a virus such as West Nile Viru

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 20QP: Indicate in which category, transcription or translation, each of the following functions belongs:...

See similar textbooks

Related questions

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: A cell has a mutated mediator protein. a) How will this affect transcription of genes? (circle an…

A: Transcription factors and RNA polymerase II interact with mediator complexes. The key job of…

Q: What enzyme is required for the movement of transposable elements that involve an RNA intermediate…

A: Transposable elements are sequences of genes that have the ability to move or jump from one location…

Q: define gene mutation.

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Define prion.

A: Viruses are made up of protein. They either contain RNA (Ribonucleic acid) or DNA (Deoxyribonucleic…

Q: 17) Codons are three-base sequences in mRNA that specify the addition of a single amino acid to the…

A: 17) Correct answer is option d(codon are a nearly universal language among all organisms) because…

Q: Discuss the initiation of transcription (mRNA synthesis) in prokaryotes in detail

A: DNA is a two stranded structure and act as genetic material in most of the organisms . It contain…

Q: Briefly describe how the Nucleocapsid protein of rabies virus promotes the switch from transcription…

A: In Brain, rabies virus N protein plays an important role in evasion of the innate immune system and…

Q: Can the below be added to the answer: Some common cytopathic effects include: Cell rounding and…

A: Viruses, microscopic infectious agents, have a unique nature that sets them apart from other…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Explain how transcription and translation may or may not be altered by a virus such as West Nile Virus.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Explain how oseltamivir (Tamiflu) interferes with influenza virus replication.
Indicate the class of drug that is stopping polypeptide translation: change 30S subunit block ribosome attachment inhibits peptide bonding block ribosome movement block tRNA docking
What is the application of Antiviral drugs in treatment of Human Immunodeficiency virus using the concept of reverse transcription. Enumerate diseases that applies the process of reverse transcription.
Use the identity of the drug target to find the nucleic acid sequence of the gene that encodes the drug target. (Be careful; do you need to find genomic sequence, a CDNA sequence or an MRNA sequence?). Identify the start and stop codons.
A) Describe each step of the DNA REPLICATION in EUKARYOTIC organismsB) Describe each step of the TRANSCRIPTION in EUKARYOTIC organisms.C) Describe each step of the TRANSLATION. Please answer all if you can! thank you
Which of the following is a known characteristic or procesds that can lead to genetic changes in some viruses? When two different viral strains of the same type of virus infect a single individual, reassortment/mixing of segmented genome pieces can occur, resulting in new combinations of segments. Genetic rearrangements of the viral genome occurs as a result of duplicate operons in the viral genome undergoing homologous recombination. Environmental conditions trigger the SOS response in viruses, and leads to generation of errors/mutations in the viral genome. Viral RNA polymerases display proofreading capability in replicating the viral genome of certain viruses.
Define RNA interference (RNAi).
Explain the translation with its stages.
For the mutations described below, categorize them in each of the following ways: [transition, transversion, insertion, or deletion]; [synonymous, missense, nonsense, frameshift, or regulatory]; [beneficial, deleterious, or neutral] a. A mutation in the SARS-CoV2 virus changes a codon in the gene encoding the spike protein from AAG to AAC. This mutation increases the ability of the virus to spread from person to person. b. Becker muscular dystrophy results in progressive wasting of skeletal and heart muscle tissue. A patient is found to have a mutation in the dystrophin gene (DMD) in the first nucleotide of intron 25. Normally, a G is in this position, but the patient has an A. c. Fur color in house cats is affected by several genes that encode pigment-producing enzymes. One such gene is found to have an additional C after position 45 in orange cats but not in black cats.
Describe the process of RNA editing.
Which type of RNA serves as the genetic template (blueprint) utilized by the ribosome during the process of translation? Transfer RNA’s (tRNA) Messenger RNA’s (mRNA) Ribosomal RNA’s (rRNA) RNA Polymerase
Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.