The codon chart is shown below, what amino acid sequence does the mRNA sequence: 3' UUUCCUCAA 5' code for? /207962/quizzes/382667/takeThe codon chart is shown below, what amino acid sequence does the mRNA sequence: 3'UUUCCUCAA 5' code for?Valine3½ArginineGlutamicacidAsparticAlanineSerineUCOTOCOAGUCAGUCAGUCAGG UGACacidULysineAsparagine1130563254025501UGCARNA Codon Chart3'ThreonineAO serine-histidine-glutamineO leucine-threonine-glutamic acidO phenylalanine-proline-glutamineasparagine-serine-phenylalanineQ SearchсO phenylalanine-proline-histidineGlycineGMethionineAPhenyl-alanineLeucineCIsoleucineinGACUGACU GACU GA000700UUGCArgininePLGlutamineSerineGCTyrosineUHistidinePOSOAGUDUAU|StopCysteineStopGTryptophan970CsLeucineProlinea3'1W

The genetic code is the set of rules by which the information in DNA and RNA is translated into…

The codon chart is shown below, what amino acid sequence does the mRNA sequence: 3¹ UUUCCUCAA 5' code for? Alanine Valine 3' Arginine Serine acid Glutamic Aspartic acid U G Lysine A G C 4020402040SOTS U اد C Asparagine A RNA Codon Chart 3% Threonine AGUCAG A с leucine-threonine-glutamic acid O phenylalanine-proline-glutamine asparagine-serine-phenylalanine O serine-histidine-glutamine O phenylalanine-proline-histidine Methionine G GU A Phenyl- alanine Isoleucine in UCAGUCPG|UO|PO| U G GACUGACU GACU GADUOTOG U C Arginine Serine A Glutamine U Tyrosine Histidine Stop Cysteine Stop GTryptophan Leucine Proline 3'

The codon chart is shown below, what amino acid sequence does the mRNA sequence: 3¹ UUUCCUCAA 5' code for? Alanine Valine 3' Arginine Serine acid Glutamic Aspartic acid U G Lysine A G C 4020402040SOTS U اد C Asparagine A RNA Codon Chart 3% Threonine AGUCAG A с leucine-threonine-glutamic acid O phenylalanine-proline-glutamine asparagine-serine-phenylalanine O serine-histidine-glutamine O phenylalanine-proline-histidine Methionine G GU A Phenyl- alanine Isoleucine in UCAGUCPG|UO|PO| U G GACUGACU GACU GADUOTOG U C Arginine Serine A Glutamine U Tyrosine Histidine Stop Cysteine Stop GTryptophan Leucine Proline 3'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked
The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
2015347/quizzes/5825797/take 17. The DNA code for a gene is: TAC GGG ACA GCG. What is the codon for the mRNA? DNA coding strand bases messenger RNA non-coding strand O TAC GGG ACA GCG ATG TTT TAT CGC O AUG CCC UGU CGC O Ala-Phe-Ser-Lys O Morc than one correct answer
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets. 2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body. 3. A nucleotide sequence that is complimentary to the mRNA codon. 4. A condition that depicts injury or diseased state of liver. 5. Term used to describe a process or condition which affects the general body function. 6. A type of virus that attacks the respiratory system to cause flue 7. The fluid found within the cell 8. A condition which describes harm, damage or impairment of kidney function. 9. To spilt a molecule or chemical bond. 10. The protein coat or shell of a virus
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.