The cladistic classification of apes and humans A. Divides hominids into hylobatids, pongids, and hominids B. Includes tarsiers, lemurs, and lorises C. Uses the term hominid to describe only humans and their ancestors D. Includes three subfamilies within hominids: Ponginae, Gorillinae, and Hominiae

Q: Lic ns ue Qu Que HO CH₂OH OH H H₂N- O CH₂ CH₂ CH₂-N(CH₂ CH₂ CH₂CH-CH₂ 0-810 O OH · ¡ 6 6 6 6 6 6 6 -…

A: Amino acids are organic compounds that contain both amino and carboxylic groups. Carbohydrates are…

Q: 1.10 (a) Determine the rate of oxygen removal from the lung venules for the following conditions:…

A: Introduction :  The main respiratory organs in both humans and the majority of other animals are the…

Q: Explain the impact of nitrosamines ?

A: Nitrosamines are organic compounds with the chemical formula R2N-N=O, where R typically represents…

Q: A. Detecting Dextrin in Starch 1. Iodine Test for Starch Describe any change that took place when…

A: The iodine test is the biochemical test used to detect the presence of starch. The starch reacting…

Q: A healthy couple had their first child affected by cystic fibrosis. Their next three sons were not…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homozygous…

Q: Among the stages of scientific inquiry, the stage of hypothesis comes immediately after the stage…

A: Scientific inquiry It refers to the many methods through which scientists investigate the natural…

Q: ree groups of plants are grown in the same location in a greenhouse, each receiving the ame amount…

A: An experiment is a scientific investigation in which  a point is proved by giving a certain…

Q: You have mutated Trypsin by replacing Asp 189 in the specificity pocket with Arginine. Which…

A: Trypsin is a proteolytic enzyme that cleaves at the carboxy terminus of lysine and arginine.Remember…

Q: Question 8 You have performed a peptide conjugation reaction in which the peptide shown below forms…

A: The products formed from the peptide conjunction reactions are in the form of 1-mer, 2-mer, 3-mer…

Q: Which of the following marks an important event during telophase? O nuclear envelope starts to…

A: Mitosis is a type of cell division that divides a cell into two daughter cells without changing the…

Q: Which characteristic of water makes it a universal solvent? A. O weak bonds B.O polarity G.O…

A: Introduction Almost 75% of the human body is composed of water. About 70% of the earth's surface…

Q: What causes regular cocaine users to chose that "initial high"?

A: Cocaine, a highly addictive stimulant narcotic, is derived from the leaves of the South American…

Q: Derived characteristics are A. The series of apparent adaptations that are never actually used B.…

A: Introduction  A trait or character is a characteristic of a living thing. It belongs to the…

Q: The Mayor of the City is best compared to which part of the cell?*       Nuclear Envelope…

A: Cell is the basic structural and functional unit of life. Organelles present in the cell are like…

Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…

A: The simplest definition of gene expression is the production of the gene's complementary protein,…

Q: g1 and g2 checkpoints

A: Cell division: The cell-division is defined as the series of events which take place in the cell…

Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…

A: MITOSIS It is also called the indirect / somatic or equational cell division. Daughter cells have…

Q: A study was done with mice to see if there is a biological basis behind compatibility in friends and…

A: Social integrity: This element of Levine's theory emphasizes the relevance of interpersonal or…

Q: Sudupe

A: Chromosomes are the condensed form of nucleic acid. The chromosomes are formed during the cell…

Q: C. In 1928, Sir Alexander Fleming was studying Staphylococcus bacteria growing in culture dishes. He…

A: Bacteria are prokaryotic microorganisms very much capable of causing a disease. On the other hand,…

Q: Which of the following would inhibit the activity of TGF-Beta receptor? multiple answers    A.…

A: Signaling molecules in the body allow cells to react to altering external surroundings. Cells…

Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…

A: The cell division in eukaryotes follow a cyclical events in which the the cell grow in size,…

Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle? ODNA…

A: A cell cycle is a series of events that takes place in a cell as it grows and divides into daughter…

Q: Give two strategies that our agricultural community can use to climate-smartly agriculture and adapt…

A: Introduction:- Since the beginning of agriculture, farmers have had to adjust to the conditions…

Q: Od ammonification QUESTION 13 The geothermal gradient is due to a decaying radioactive elements that…

A: Introduction :- The rise in temperature with depth in the Earth's crust is known as the geothermal…

Q: Increases in the incidence of a disease may be due to a(n): O Increase in the infectivity of an…

A: Ans: Increase in the incidence of disease can be stated as the occurs of new cases in the population…

Q: Consider molecule #1. How does the term amphipathic relate to this molecule? It is a large nonpolar…

A: Compound lipids are fatty acid esters containing additional groups such as phosphate sulphate sugar…

Q: 2. The accompanying pedigree concerns a rare inherited dental abnormality. a) What mode of…

A: A pedigree representation is a family tree that depicts the pattern of inheritance of traits…

Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase?

A: Introduction :- In the processes of mitosis and meiosis, the long, thin chromatin strands are…

Q: 3- How do Steroids enter the cell?

A: Hormones have typically been divided into two groups: hydrophilic peptides or amino acid…

Q: Name 5 different physiological systems that are influenced by drugs

A: Drugs cause a brain reaction that alters how the body feels. The brain, which serves as the body's…

Q: The frequency of both alleles in a population is 0.5. If there are 100 individuals homozygous for…

A: Hardy Weinberg Equilibrium (HWE) states that the frequency of alleles in a population remains…

Q: Evidence supports that feathers evolved before flight, and were later co-opted for flight. This is…

A: Any net directional change or cumulative change in the characteristics of organisms or populations…

Q: How is dopamine affected by chocolate and cocaine similar and different

A: Since you have asked multiple questions, we will slove the first question for you. If you want any…

Q: Initially, she may present her data and condusions at a scientific conference whe tists. Later, she…

A: Science is the coolest subject that revolves around every testable and prediction around the world.…

Q: Calculate the average number of nucleotide pairs pero micrometer of DNA double helix according to…

A: Watson and Crick's model of DNA James D. Watson and Francis H. Crick suggested the…

Q: Which event may take place before metaphase? O reformation of nuclear membrane O cytokinesis DNA…

A: Introduction  In the eukaryotic cell cycle, mitosis is a stage during which the chromosomes are in…

Q: Discuss the relationship between viruses and endocytosis. Compare bacteriophage AND animal viruses…

A: Virus (intracellular parasite) is an infectious organism having Nucleic acid and protein coat. It…

Q: Place the terms or connecting propositions (phrases) on the left into the best open spot on the…

A: The scientific method is the systemic approach to research that starts from an observation that…

Q: G1 phase cat cells will have 19 pairs of chromosomes. In a cat cell in metaphase of mitosis .. A.…

A: Introduction  The process of reproduction known as cell division requires all cells to make a…

Q: 10. What if you placed the same cells into pure, distilled water (0% saline solution)? (Circle one…

A: Osmosis is the movement of solvent from a region of lower solute concentration to a region of higher…

Q: Which of the following is a chemical modification that can be found on both nucleotides and amino…

A: DNA  It is a genetic material found inside a double membranous nucleus in eukaryotic cells.

Q: 6. Indicate the appropriate SI unit and instrument to use to measure the following: a. Mass of a…

A: Introduction A living organism possesses vital energy to sustain life. The living organism can…

Q: important role of science and technology in the environment sector

A: Technology has had a profound impact on society, the economy, and the environment.

Q: Which of the following marks an important event during telophase? O nuclear envelope starts to…

A: The M phase, which involves significant restructuring of almost all cell components, is the most…

Q: How could you generate an estimate of total NPP from all producers in system like a lake, pond, or…

A: Net Primary Productivity (NPP), is the production of plant biomass in an ecosystem.  Production…

Q: 2. Primates have evolved across the continents over the last 70-80 MY. Let's consider the species…

A: DNA sequences may provide information to the researchers if they have uncovered a new species.…

Q: Clear water is a type of the following: O a. Solvent O b. Solute Oc. Solution O d. A and C Oe. All…

A: The branch of science that deals with the biochemical reactions that is occurring within a living…

Q: Direction: Study the representation of the stages of mitosis below and answer the following…

A: Mitosis is the process by which one cell divides into two genetically identical daughter cells.

Q: What is the function of the stigma in protists such as Euglena and Chlamydomonas? As the world's…

A: Introduction  : Algae are living organisms that are found all over the earth. They develop in a wide…

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth.  Human evolution is an outcome of interaction among the following processes: