12:18# א[Template] SAS46PART 5: Mutations Background InformationMutations are changes in the DNA of an organism. These mutations can be harmful, helpful or neutral(not having any impact on the organism at all.) There are three types of mutations-insertion, deletion andsubstitution.Substitution mutations occur when a single base pair is substituted for the correct base. For example, if asection of DNA is ATTCG, the mutated strand could be ATTGG.Insertion mutations occur when one or more base pairs is added (inserted) to a DNA sequence. Forexample, if a section of DNA is ATTCG, the mutated strand could be ATATCG.Deletion mutations occur when one or more base pairs are omitted from a DNA sequence. For example,if a section of DNA is ATTCG, the mutated strand could be ATCG.Mutations can happen for several reasons.A. DNA fails to copy accurately. Most of the mutations that we think of are "naturally-occurring." Forexample, when a cell divides, it makes a copy of its DNA – and sometimes the copy is not quiteperfect. That small difference from the original DNA sequence is a mutation.B. Mutations can be caused by environmental factors such as Ultraviolet Radiation (UV), X-rays andsmoking tobacco. Examples of diseases caused by environmental factors resulting in mutationswould be skin and lung cancer.C. A mutation can be inherited if it exists in a sperm or egg cell. Examples of common inheritedmutations cause Cystic Fibrosis, Huntington's and Hemophilia.19. Summarize what you learned from the reading to answer the question- What causes mutations?II

Name: 12:18# א[Template] SAS46PART 5: Mutations Background InformationMutat
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 12:18# א[Template] SAS46PART 5: Mutations Background InformationMutations are changes in the DNA of an organism. These mutations can be harmful, helpful or neutral(not having any impact on the organism at all.) There are three types of mutations-ins

Mutations are changes in the DNA sequence of an organism which may or may not affect its phenotype.

Answered: + [Template] SAS4

Science

Biology

+ [Template] SAS4

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter3: Biological Macromolecules

Section: Chapter Questions

Problem 20RQ: How does the double helix structure of DNA support its role in encoding the genome? The...

See similar textbooks

Similar questions

11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
Faulty DNA repair; ii) Gain-of-function; and iii) Trinucleotide repeats provide genetics disorders Give examples of mutations with each disorder.
7:12 You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding sequence of the heat shock protein gene. This gene is cloned in a plasmid and you want to confirm that the mutation was correctly introduced. Which sequencing technology be most appropriate to use practically and economically: O Microarray O Sanger sequencing O RNA sequencing O Exon sequencing
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
12:18 A Bell Ringer for We.. / Bell Ringer for Wednesday Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2. AGAGAUUCAGCUAGCACGAUA 3. GUCAUCGAUCGAUCGGAUGCC 4. UUUCAGUCAGCUAGCGAUCGU 5. CUAAUGUGGAUCCUGAACGCU Use the codon chart to translate the amino acid sequence for the given MRNA strand. Below each codon, write the 3-letter abbreviation for the corresponding amino acid. A G A G U UU GAGA UCUGGUUGGAA AG CGUA uUA A c GUAU A G G A U C G A U G G G GU G clu UA G cUA G A II
39 The Central Dogma describes the flow of genetic information as follows: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a RNA TO DNA TO PROTEIN DNA TO PROTEIN TO RNA DNA TO RNA TO PROTEIN PROTEIN TO DNA TO RNA
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.