Sweetzyme IT Extra is a trademarked immobilized enzyme formulation of glucose isomerase sold by the Danish company Novozymes. The following reaction is carried out in a 4.0 L reactor in the presence of an non-competitive inhibitor, I: E + G <=1=> EG =2=> E + F EG+1 <=3 => EIG G = glucose, F = fructose The Sweetzyme beads added to the reactor have a total surface area, a = 342 cm². Kinetic Parameters k₁= 0.00820 M-¹ s¹ k.₁ 0.00190 s¹¹ k₂ = 0.570 s¹ Initial/Total Enzyme concentration: Initial Bulk Substrate Concentration: Mass transfer coefficient, Eo 2.30 x 105 M Sb = 0.152 M k₁= 9.15 x 10 cm/s A. What is the maximum reaction velocity with no inhibitor (in mol/L-s)? (recall that Rapid Equilibrium and Quasi steady state approaches predict the same value for Vmax for this mechanism) B. What is the maximum reaction velocity (in mol/L-s) with the non-competitive inhibitor, I, at a concentration of [1] = 0.0029 M, with K₁= 1.8 x 10³ M.
Q: Create a concept map to demonstrate the relationships between carbohydrate, protein and lipid…
A: Glycolysis is a metabolic process that occurs in the cytoplasm of cells, where glucose is converted…
Q: If 10x TBE contains 0.89 M Tris-borate, 0.89 M Boric acid, and 0.02 M EDTA, what is the Molar…
A: Molar concentration is a measure of the amount of a substance in a given volume of solution. It is…
Q: The reaction S-> P is catalyzed by an enzyme that follows Michaelis-Menton kinetics. From the…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: 1.In this model, the substrate still needs to fit into the enzyme like a key, but instead of simply…
A: Since you have posted multiple questions, we will provide the solutiononly to the first five…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: please answer and expalin in detail Please provide only typed answer solution no handwritten…
A: The citric acid cycle (also known as the TCA cycle or Krebs cycle) is a series of chemical reactions…
Q: That is the lactase assay Calculate initial rate
A: Lactase assay is sensitive enzymatic method to estimate the lactose in low-lactose or lactose-free…
Q: A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of…
A: Enzymes are protein that catalyse biochemical reaction. They speed up biochemical reaction but do…
Q: dentify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In…
A: Introduction There are 4 types of biomolecules present in our body, protein, carbohydrate, lipids…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…
A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: 3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and…
A: The expression of proteins in a prokaryotic or eukaryotic cell involves transcription and…
Q: When the disaccharide is hydrolyzed, the monosaccharide units that are produced are
A: Carbohydrates are one of the three macronutrients that provide energy to the body, the other two…
Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…
A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…
Q: A genetically modified bacterium was cultivated to produce 1,3-propanediol (1,3-PDO), and the…
A: Oxygen Demand is a measure of the amount of oxidizable substances in a water sample that can lower…
Q: For each of the following human sex chromosome combinations, indicate whether you would expect them…
A: The determination of a baby's sex is determined by the combination of sex chromosomes they inherit…
Q: 3. Tyrosine kinase receptors are pairs of proteins that span the plasma membrane. On the…
A: Enzymes can exhibit cooperativity, which refers to the phenomenon where the binding of a substrate…
Q: 3) Which statement explains a way in which a researcher could cause a cytoplasmic protein to…
A: process of transporting cytoplasmic proteins into the nucleus 1. cytoplasmic protein contains an NLS…
Q: If the enzyme maltase has a Vo of 0.25 mM per minute when [S] = 0.10 mM, and a Vo of 0.40 mM per…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: 1. Explain the biochemical formation of creatinine, urea, and uric acid. 2. State the principle of…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 5. The amino acid sequences of three peptide fragments are shown below. Peptide 1: QAMGRAGDLKYLGLHSV…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: The central dogma of molecular biology explains how the nucleotide sequence in DNA acts as a…
Q: For the peptide structure in #3, (ASP-ALA-THR-LYS-GLY), A. Determine the net charge of the…
A: pKa is the pH at which a weak acid is 50% dissociated. If the pH is less than pKa, the ionising…
Q: 2. Consider the following quaternary cartoon structure below, where each colored shape represents a…
A: Some proteins are composed of more than one polypeptide chain. Each polypeptide chain folds to…
Q: 5 When your body metabolizes fat for energy, it gets 9 Cal./g, as opposed to only 4 Cal./g from…
A: Adipose tissue is a type of connective tissue which comprises fat cells, or adipocytes, which store…
Q: A man and woman are both carriers for the recessive mutation that causes cystic fibrosis (genotype…
A: The probability that none of the children would have cystic fibrosis (genotype dd) can be calculated…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: Question 2 - Which of the following is required for import of mitochondrial matrix proteins? (select…
A: Most of the enzymes and other proteins required by mitochondria is encoded by the nucleus, despite…
Q: 7) The following are a product of the ester hydrolysis of a lipid which contains three esters.…
A: Simple lipids are esters of fatty acids with glycerol, i.e. it forms ester bond with alcohol,…
Q: The unicellular fungus Saccharomyces cerevisiae is used in the food industry to ferment sugars. The…
A: In animals, Pyruvic acid has two possible fates in the cell: be oxidised into acetyl CoA and enter…
Q: 10 glucose molecules are used in anaerobic respiration. How many ATP will be yielded under these…
A: Cellular respiration occurring when oxygen is absent is known as anaerobic respiration. It is a…
Q: HO H. OH 2-H OH OH 20. To the left is the structure of ribose, with (most of) the carbons numbered.…
A: Ribose is a five-carbon monosaccharide that is a component of nucleotides, the building blocks of…
Q: The four drugs A, B, C and D have the same IC50 values. Which of them has the highest efficacy? 100…
A: Drugs are substances that can alter the body and mind, and are often used illegally to create a…
Q: Inhibitors are important in developing new pharmaceuticals. Two important classes of inhibitors…
A: Inhibitors are molecules or compounds that reduce the rate of a chemical reaction, or block it…
Q: A 24-residue peptide called Pandinin 2, isolated from scorpion venom, was found to have both…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: A. Briefly discuss the four levels of structure in proteins.
A: "Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The figure above represents changes in different types of metabolic pathways (y-axis) as energy…
A: Metabolism is the sum of all biochemical reactions in a living system that are responsible for it's…
Q: In which phase of aerobic respiration is the main part of ATP formed? Electron transport chain…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 2. To track the insulin purification process, the ratio of insulin to total protein is tracked…
A: To study the physical and chemical properties of insulin, it must be separated from the mixture of…
Q: Write schematically the synthesis of phosphatidylcholine from phosphatidylethanolamine. What…
A: Lipids are chemically diverse group that have two things in common: low solubility in water and high…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: 6. Sickle cell anemia is a genetic disease resulting from a single amino acid substitution…
A: The following steps describe the structure of normal and sickle cell hemoglobin and explain the…
Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…
A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: If you are a medical technologist, which of the four methods of glucose determination would you…
A: Determination of glucose level in blood and urine helps us to diagnose diabetes and many other…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Q: Discuss the similarities and differences between DNA and RNA. Be specific and use your own words.…
A: DNA stands for deoxy ribonucleic acid where as RNA is ribonucleic acid. Nucleic acids are the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Figure 27.3 illustrates the response of R (ATP-regenerating) and U (ATP-utilizing) enzymes to energy charge. a. Would hexokinase be an R enzyme or a U enzyme? Would glutamine: PRPP amidotransferase, the second enzyme in purine biosynthesis, be an R enzyme or a U enzyme? b. If energy charge = 0.5: Is the activity of hexokinase high or low? Is ribose-5-P pyrophosphokinase activity high or low? c. If energy charge = 0.95: Is the activity of hexokinase high or low? Is ribose-5-P pyrophosphokinase activity high or low?A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of protein P. The product of the hydrolysis reaction absorbs at 410 nm with a molar extinction coefficient of 4 000 M-¹.cm-¹. 1- Write the reaction catalyzed by the protease P using the pNPA substrate. 2- The enzyme extract is too concentrated and a 1/300 dilution is needed for enzyme tests. Considering that you would need at least 600 µL of diluted enzyme extract for activity tests, indicate which volume of buffer and enzyme extract you must use for the dilution.#1 Specify the role each of the following amino acids play within the crystal structure and/or active site for Be as specific as possible, with pictures (and mechanistic arrows) as necessary. His11 Arg140 Glu89 Trp68 #2 Provide a step-wise mechanism for the reaction Bisphosphoglycerate mutase catalyzes, using the amino acids responsible for aiding in catalysis. You do not need to add surrounding amino acids that aid in substrate specificity. (drawn out)
- Below is a plot of Vo vs. [S] for a specific allosteric enzyme under different conditions. Which of the following best describes the graph? 4 (S] O Adding a positive modulator to #2 would result in curve 3. Curve 1 represents maximum inhibition. Line 4 is valid exclusively for curves 1 and 2. Adding a positive modulator to #1 would result in curve 2. O Curve 3 represents the effect of a negative modulator added to curve 2.The protein catalase catalyzes the reaction 2H,O,(aq) — 2H,O(l) + O,(g) and has a Michaelis-Menten constant of KM = 25 mM and a turnover number of 4.0 × 107 s¯¹. The total enzyme concentration is 0.010 µM and the initial substrate concentration is 4.83 µM. Catalase has a single active site. Calculate the value of Rmax (often written as Vmax) for this enzyme. Rmax Calculate the initial rate, R (often written as V), of this reaction. R = ×10 mM.s-1 mM-s-1A catalyst like lactase that assists in the metabolism od milk is best described as Group of answer choices homogeneous heterogeneous enzymatic non-truseable 7, What graph will demonstrate that experimental concentration data fit a second-order reaction? Group of answer choices ln[reactant] vs. time ln(k) vs. 1/T 1/[reactant] vs. time [reactant] vs. time ln(k) vs. Ea
- Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1. Substrate concentration 1. The above graph is an enzyme reaction, what is the vMax, KM, and Kcat of this enzymatic reaction? What does vMax, kM and Kcat mean, explain? 2. What are the three forms of regulation that follow the Michaelis Menten kinetics? What are the mechanisms by which these inhibitors can regulate the enzyme?The KMof the enzyme for the substrate adenosine is 3 × 10ꟷ5M. The product inosine acts as an inhibitor of the reaction, with an inhibition constant (KI, the dissociation constant for enzyme-inhibitor binding) of 3 × 10ꟷ4M. However, a transition state analog,Inhibits the reaction with KIof 1.5 × 10ꟷ13M. Explain why 1,6-dihydroinosine serves as a better inhibitor of adenosine deaminase than inosine. Elaborate on your answeShown below is a substrate for a Trypsin. Draw the mechanism for this serine protease using the artificial substrate. Be sure to draw the catalytic triad, and show the role of the oxyanion hole. Draw the complete structure of every intermediate and product and PUSH ARROWS!!!!! Do not abbreviate structures using R and R' H₂N _N_CH. сно CH₂ CH₂ CH₂ NH d=19H₂ NH₂ O CH- H₂C HN O CH
- 1. Please fully explain (use illustrate where appropriate) the Modes of Enzyme Catalysis exemplified by the serine protease: Chymotrypsin. In your answer discuss employing the illustration whenever possible: the overall reaction mechanism, stability of the reaction transition state, proximity and orientation effects, acid-base catalysis, and covalent catalysis. (c) (0) Ap Asp Toe His Asp 10 C-N bond cleavage HN Ho Ser Ger Binding of substi 196 Ser Gly alto video LBHB NH Sere HAR Proton donation by H (h) Fel of amino product yest OHN Hig Ser Ap (0) Formation of covalent (ES) Alp Me complex SeriosMatch the different names for inhibition mechanisms (1-5) with a description of their properties 7a-7d: 1. competitive inhibitor. 2. allosteric inhibitor also known as non-competitive inhibitor. 3. un-competitive inhibitor. 4. affinity label also known as active site directed covalent (irreversible) enzyme inhibitor. 5. Kcat inhibitor, also known as a mechanism-based covalent (irreversible) enzyme inhibitor. 4a. An enzyme inhibitor in which a substrate or competitive inhibitor is modified so that it contains a chemically reactive electrophile which can bind to and subsequently react with the enzyme active site: 4b. An enzyme inhibitor that contains latent reactive group that upon binding followed by catalytic turnover at the enzyme active site produces a reactive electrophile that reacts covalently with the enzyme: 4c. A reversible inhibitor that competes with the substrate for binding to the enzyme active site: 4d. A reversible inhibitor that can bind independently of substrate to its…A purified protease enzyme from the fungus Aspergillus sp. Is tested in a laboratory. This enzyme was lyophilized as a white powder. When reconstituting with phosphate buffer pH 7.2 the active enzyme is obtained. To check its purity, an electrophoresis is performed where a single band of approximately 70,000 molecular weight is observed. The solution with enzymatic activity was stored at 4ºC for later use. A few days later it was found that the enzymatic activity had been lost and in the electrophoretic analysis, instead of a single band there were three bands of weights 40,000, 20,000 and 10,000. Come up with a reasoned explanation of what might have happened to the enzyme