Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino acid activation rather than that of codon–anticodon recognition.
Q: Discuss the role of GTP in the functioning of translationfactors.
A: Introduction GTP is defined as an energy-rich kind of nucleotide that is analogous to a molecule of…
Q: Discuss and make a list of the similarities and differences in theevents that occur during the…
A: The synthesis of a single-stranded RNA from double-stranded DNA where the sequences of RNA are…
Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…
A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.
Q: Question:- Which statement below about gene expression is TRUE? A. Transcription initiation begins…
A: A gene is a part of DNA that codes for a particular protein. Each Jean carries a particular set of…
Q: Please answer fast True or False During transcription in prokaryotes, the initiation of…
A: Transcription is a process in which the double stranded DNA is converted to RNA which is translated…
Q: Promoters of the INS gene
A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…
Q: Illustrating the importance of triphosphate and monophosphate molecules, explain the process of RNA…
A: RNA is a polymer of ribonucleotides.
Q: Matching type: Choose the effect of the given agents to translation or transcription Choices: RNA…
A: Transcription and translation are the processes by which a gene can express itself in the form of…
Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…
A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…
Q: In describing the triplet binding assay, an undergraduate with limited knowledge of translation…
A: Every three nucleotides in a row count as a triplet in the genetic code and codes for a single amino…
Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…
A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…
Q: "Translation Is More Complex in Eukaryotes " Explain this ?
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…
A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: Translation in prokaryotes: Does the initiation of translation in prokaryotes rely on initiation…
A: The initiation factor does not bind to the Shine-Dalgarno sequence, instead, they are associated…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: Explain why aspartate residues play an important role on the active site of DNA polymerase.
A: Before getting into the answer let's understand what is aspartic acid. Aspartic acid (or aspartate)…
Q: GTP hydrolysis is used multiple times during the course of protein synthesis to advance the process…
A: A) To find: An example of a GTP-regulated step and its associated GTP binding factor that regulates…
Q: _____ Mutants Are Useful in ______ the Order in Which Proteins Function.
A: Saccharomyces cerevisiaes, or baker’s yeasts, unicellular fungi are useful in understanding genetics…
Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…
A: The initiation codon is also referred to as start codon which marks the beginning of the translation…
Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…
A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…
Q: 3. Describe the properties of genetic code?
A: DNA is the genetic material present in the cell. It regulates the expression of organism.
Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…
Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…
A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…
Q: MRNA degradation in eukaryotes occurs using endonuclease exonuclease both
A: mRNA It is a single strand of RNA which contains gene that code for specific protein. mRNA is…
Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…
A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…
Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…
A: According to the central dogma, the most common pattern of information in our cells is: From…
Q: Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed…
A: The peptide bond is also similar to an amide bond that helps to join two amino acids and make a…
Q: The possibility of a single locus in a DNA to code for different mRNAs. If this is possible, what…
A: The possibility of a single locus in a DNA to code for different mRNAs. If this is possible, what…
Q: Assuming the translation product is an enzyme, explain its role in the final expression of a…
A: Cental dogma in molecular biology explains how the information coded in the our DNA molecules flows…
Q: Select any of the choices that would be considered a post-transcriptional modification of…
A: Since you have posted multiple question, we will solve the first question for you. If you want any…
Q: Di- and trinucleotides are occasionally released from RNA polymerase at the very start of…
A: The biochemical substance that is carried forward from the preceding generation to the succeeding…
Q: EF-Tu, a member of the G-protein family, plays acrucial role in the elongation process of…
A: Translation or protein synthesis is the process by which the genetic information from DNA is passed…
Q: Translation. Write the anti-codon sequence of the mRNA transcript. Translate the MRNA transcript…
A:
Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…
A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…
Q: How Nirenberg and Matthaei determined the first specific codon assignment—UUU codes for…
A: The process by which RNA molecules are synthesized from DNA is transcription. Gene is the working…
Q: specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from ts…
A: INTRODUCTION Amino acids are the building blocks of proteins and nitrogenous backbones of…
Q: Comment on the accuracy of the aminoacylation during the charging of tRNA to ensure the fidelity of…
A: Amino acid activation or commonly known as tRNA charging, refers to the attachment of an amino acid…
Q: Does lysyl-tRNA synthetase have a proofreading capability? If so, what are other amino acids can you…
A: The translation is considered as the process, in which polypeptide is synthesized with the help of…
Q: Why is it necessary for an in silico translation tool to provide 6 different frames of the…
A: The open reading frame or the ORF is the gene region that can get translated by the translational…
Q: The enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC):…
A: Site directed mutagenesis can be defined as the method to perform certain changes in the double…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying…
A: Central dogma means the flow of information occurs from DNA to RNA, and RNA to proteins. Proteins…
Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino acid activation rather than that of codon–anticodon recognition.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- briefly explain the importance of the degeneracy of the genetic code in the translation process. do not simply define the givenThe genetic code is both universal and degenerate. Explain how these aspects are an advantage, but also a potential disadvantage to heterologous protein production.Post-translational modification of proteins refers to the covalent and enzymatic modification of proteins following protein biosynthesis. Give three (3) examples and briefly describe why the modification is important.
- True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation start site?Recall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Aminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code. Explain.Translation work is an essential step for protein synthesis. In order for the protein to be synthesized what must be recognized first in translation? How does this important part in translation have an effect on the rest of the reaction? Please provide a valid argument. Be as detailed as possible.
- Mass spectrometry is a powerful tool in proteomics. What are the four key features of a mass spectrometer? Describe briefly how MALDI and two-dimensional polyacrylamide gel electrophoresis could be used to identify a protein expressed in cancer cells but not in normal healthy cells.BIOCHEMISTRY Which methodologies can be used to detect the expression of a given protein? Please provide pros and cons of each mentioned approach.Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)