जन्का ली देकर परार देेल लब्पsogene sn जाक ? A) Hn iso2gme cam be Coeed 0Siलह कसक्ट कर Te १riance সजपलकप्ठ o 1802ूne वाc (बcni cal im all is Fouve हxplबाक Usimg kimade emjace B) फेछयाष्हन ८) )ऊयाग्ट वाट ताककपू लTेथधध ठिन्ल नान्ए ४me gere कnd भ्ये इताced नेमवाजलापू. m the Same ৪e শা
Q: What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a…
A: Introduction: Sickle cell anemia is an autosomal inherited blood disorder that affects hemoglobin…
Q: Can you please help me answer the following question in three paragraphs and in your own words.…
A: Enzymes are substances that enhance the rate of chemical reaction and facilitate the formation of…
Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…
A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…
Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…
A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…
Q: A. Effect of pH with enzymatic activity. Include example of enzymes optimum pH. B. Effect of…
A: The enzymes are biological catalysts, that enhance the rate of biochemical reactions. The factors…
Q: Which of the following is the CORRECT relationship?
A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: Polysaccharides may gel through a variety of different mechanisms. Which of these statements is…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: 4. Apolipoprotein B is a protein that binds lipids and carries them around the body. One of the two…
A: The rate of translation varies amongst prokaryotes and eukaryote. In prokaryotic cells this rate is…
Q: After intense activity, your muscles feel sore because of ______. Group of answer choices the…
A: During intense activity our body needs more energy (ATP).
Q: Compare and contrast DNA replication and PCR.
A: Dna replication is the process of Synthesis of new daughter dna molecules or duplication of parent…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Fill in the blanks in the table below regarding the similarities and differences between two…
A: The replication of DNA involves opening up a double-stranded DNA molecule and creating a…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: d) Which reactions are predicted to be far-from-equilibrium? Explain your rationale. e) What type of…
A: Glyoxylate cycle is an anabolic pathway that occurred in plants, bacteria, protists, and fungi in…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: i need the answer quickly
A: Vitamin B6 aids in the maintenance of a healthy level of this amino acid in the blood. A more…
Q: QUESTION; — Compare and contrast the degradation pathways of purines and pyrimidines, making sure to…
A: Nucleotides are used in nucleic acid synthesis, intermediate metabolic processes, and the breakdown…
Q: How useful to you is the mnemonic in remembering which one oxidizes and which one reduces?
A: Oxidation and reduction are two types of reactions, in which there occurs the loss of electrons and…
Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…
A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…
Q: reaction as a function of substrate concentration. Ex- plain why the maximal velocity can be…
A: Enzyme kinetics is the study of the rate of enzyme catalyzed bio chemical reactions and also we can…
Q: HO CH, H. CH2 OH I-
A: An amino group and an acid group-containing organic molecules are called Amino acids. when…
Q: v Vitamin E A. diminished intestinal absorption of lipids v Vitamin K B. night blindness v Vitamin A…
A: Vitamin are organic chemical compounds that are not synthesised by our body. They are required in…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: How does the presence or absence of oxygen influence cell
A: Metabolism is the process of extracting cellular energy from the sources like carbohydrate, amino…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: 3. In what direction (toward the anode, toward the cathode, or toward neither) will the following…
A: As like amino acids, peptides, and proteins include both acidic and basic functional groups. The…
Q: All of the following have terpene structure, except Cholecalciferol Squalene Carotenoids O…
A: Terpenes are hydrocarbons composed of 5 carbon atoms attached to 8 hydrogen atoms. Terpenes consists…
Q: 1. DNA replication is described as semi-conservative because A. one leading strand and one lagging…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…
A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…
Q: Explain how Allopurinol works to decrease Uric Acid excretion. (I
A: Allopurinol is a class of medications called xanthine oxidase inhibitors and is used to prevent or…
Q: Why in infants idiopathic hypercalcemia occurs?
A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…
Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid
A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…
A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…
Q: Blood group BA has A and B antigens on the red blood cells with no anti-A and anti-B antibodies in…
A: In the ABO system mainly four blood groups are presents : blood group A, B, O and AB.
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: rotein kinase inhibitors have become a major focus for the development of molecularly targeted…
A: Introduction: A substance that blocks the action of an enzyme is called protein kinases. There are…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Sorbitol is a carbohydrate that is classified as a sugar alcohol or polyol.
Q: Where does molecular oxygen (O2) get generated during photo-phosphorylation? Photosystem I 2…
A: The light reaction, also known as photolysis reaction, occurs in the presence of light. It mainly…
Q: Please discuss any two of the structures and functions of these 4 molecules. What do they have in…
A: 1. Main carbohydrate storage in plants. 2. Monomer - Alpha glucose 3. 1,4 -glycosidic bond in…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: Substrate cycling does not violate the laws of thermodynamics in making both directions of a…
A: The study of energy and energy transfer in physical matter is known as thermodynamics. A system is…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: The reaction given in the problem is the reaction between Pyruvate to Lactate conversion which is…
Q: What do you think is the golden contribution in the field of Biochemistry in the era of the 1800s…
A: Biochemistry is the study of biological processes at cellular molecular level by the application of…
Q: 7. What are the current treatments for PK deficiency patients?
A: Pyruvate kinase deficiency is a genetic inability to make the enzyme pyruvate kinase, which is…
Give a clear handwritten answer and Explain....?
Step by step
Solved in 3 steps
- can you explain this in a few sentences, pls ;(Arial 5 of 10 761 words Aav Po BIUab x₂ x² A.A. 2. Identify the following structures when given images such as the ones below: ● process of transcription process of translation ● ligands • receptor proteins (in either the cell membrane or in the cytoplasm or nucleus) ● nucleus ● ● nuclear membrane nuclear pores ● ribosomes ● ● DNA mRNA ● tRNA • growing polypeptide chain EX English (United States) AaBbCcDd Ee Normal mana | AaBbCcDdl No Spacing MacBook Air | AaBbLCUC Heading 1 Heading 2 Focus E F Title E Styles Pane I"Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and specify the other subparts (up to 3) you’d like answered." as you said you will answer anohher 3 subpart in another qouestion please please do so, as i already subscribe it also i need a fully comprahesively explanation from your kind Experts. thank you so so much
- M Snip & Sketch M Inbox (3,950) W WhenToWork.c x A Timecard Entry x S Elementary Fre x O Messenger O (745) ABEN X New Tab b Ask a Question x + A mail.google.com/mail/u/O/#inbox/FMfcgxwKjnfKdVsppsLnvdFtzwZGWsWV?projector=1&messagePartld=0.1 Updates Ready to Install Restart Do you want to restart to install these updates now or try tonight? E Apps O YouTube о Марs GE News M Gmail C Chegg study Later Screenshot 2020-12-11 200124.pngearch mail Open with - 1 of 2,564 - Compose Inbox 1,694 lidiyaPlease fill the blanksНавчын баганан эсэд байдаг боловч элэгний эсэд байдаггүй эрхтэнцэр аль нь вэ? А. Эсийн мембран бүрхүүл б. Эсийн хана В.Хлоропласт Г. Эсийн сийвэнasap please need help with these three ONLYDownloads G https://quizizz.com/joln?gc 組■回 O O 4x * -> A quizizz.com/join/game/U2FsdGVkX19TkkG3kLlisiMvowuyNnqAj4DOrKAİ%252BrxJxaTyev6Woj05VE1vYBQ81Qrk%252.. DeltaMath G Sign in - Google Ac. C Campus Portal Desmos | Graphing.. O Copy of Cherish sto. G Continue the Conve. 国 Readil HCS Bookmarks Y 10th 27500 +200pts What is the art of persuasion? rhetoric pathos ethos logos Music off O v1 3:17 CopCATGATACAAGGCCCTTCCGGTACAACCACTTCGGTAGAAAGCCTTTCGGAGACCGTCCCTTOGGCAGACGCAACmI cear CA PESCA CROOngm O uaNOCIGa P L CEIC00PORMORlg mcaGccCTTCCGGT 916 10 5'UTR 20|JATG 3b 50 Leader 60 80 100 1 110 130 160 2 40 70 90 120 140 150 170 180 190 ....I....I....I....I.. ..r....I........I....I....I....I....I....I........I....I....I....I....I....I....l....I....I........I....I....I.......I....I....I....I....I....I....I.........I .1....I.... DQ183132 DQ183133 DQ183134 ...2 -TCGGAGAGACTATTACTAACATG TCGGAGAGACСТАТТАСТААФАТО TCGGAGAGACCTATTACTAACATG 3 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCCCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185 GTGAAAGTGACACTGATCGTTGCCATTGTGGCTGCTCTTGCTATCTCAGCTCACGCACAAAGAGATTACAATGAACTACGAGGAAATAAGAATGGCAGAGAGAGAGGACAAGGTCGCTTTGGAGGAAGGCCGGGTGGAATGCAGATGGGTGGATCGAGGCA 185…ic ons ue Qu Que CH₂OH H/ HO 업 H € . 1 6 6 6 6 6 6 6 H H₂N-C-C Yo CH₂ 6 6 6 6 6 SH O O CH₂ CH CH₂ сос-о CH₂ CH₂ CH₂ OH OH CH₂ NICH₂ CH₂ 0 oooooo OH 15. CH₂OH HO OH H₂N* C-C CH₂ CH₂ CH₂ CH₂OH OH H 0- OH OH H HTC OH HỘ CH HO C-H H-C-OH H-C OH H H X÷L N OH H₂C HOCH, O OH OH OH CH₂ H MATCH IMAGES on the LEFT with the Appropriate Groups of molecules listed below (more than one may apply) A. Fatty acid/Lipid B. Phospholipid in plasma membrane C. Carbohydrate D. Amino Acid E. Phosphate F. Cis Isomer Ca G. Monosacharide H. DisacharideNeed both parts answeredDirections are in the imagSEE MORE QUESTIONS