Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. S..GACTAAGGCTTAG CTGATTCCGAATG5 NEW STRANDS (Fill in the correct bases and supply arrowheads.) 3'.

Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. S..GACTAAGGCTTAG CTGATTCCGAATG5 NEW STRANDS (Fill in the correct bases and supply arrowheads.) 3'.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…

A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…

Q: The limit for G-200 beads is 5000-600,000. When you pass two proteins- Protein A (75, 000), Protein…

A: Proteins are amazing molecules that make everything simple inside the cell. Proteins molecules are…

Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…

A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…

Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for…

A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's…

Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…

A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…

Q: Explain the biochemical and subsequent medical consequences of a deficiency of Myoadenylate…

A: Myoadenylate deaminase insufficiency is a metabolic muscle disorder in which the muscle cell's…

Q: One of the following is most accurate about relative redox potential of different electron carriers.…

A: Electron carriers are molecule that is capable of accepting one or more electrons (acceptor) from…

Q: In the Haworth projection for Glucose the hydroxyl on carbon 1 is shown projected up or down. b In…

A: As you have asked multiple sub part questions we are supposed to answer only first 3 subparts for…

Q: Differentiate sweet molecules in Column A using the criteria in column B.

A: Given: column A has two components which differs at different aspects as given in column B.

Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…

A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…

Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from…

A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go…

Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…

A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…

Q: Can a chemical reaction takes place without the application of enzyme or catalyst? Why or why not?

A: Introduction: A chemical reaction is a change in which one or more substances undergo conversion to…

Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state?…

A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus…

Q: Branched polysaccharides will be more viscous than linear polysaccharides. True False

A: The molecular formula of glucose is C6H12O6. Glucose is a building block of disaccharides like…

Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going…

A: Chromatography is biochemical separation method for organic molecules or solutes of a compound…

Q: Which of the following is true about cell potential? a. It is the sum of the oxidation and reduction…

A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves…

Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…

A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…

Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…

A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…

Q: Comparing stearate to palmitate, concerning beta oxidation, how many more ATP will be formed from…

A: After each cycle of beta oxidation, the fatty acid gets reduced by 2 Carbons and the end products…

Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end.…

A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic…

Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized?…

A: The above reaction is a part of beta oxidation of fatty acid process.

Q: 2. 1 Calculate the overall charge (pH 7) on the following three polypeptides and answer the…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…

Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: In a paragraph format How amylase is used/its purpose and why amylase useful in the food industry

A: Any enzyme that catalyses the hydrolysis (breaking of a substance by the addition of a water…

Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…

A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…

Q: H3C H3C. HyC O Triglyceride O Fatty acid Glycerol

A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…

Q: We have described an ATP synthase complex with an Fo complex of 9 c-subunits. Consider if the F0…

A: In order to solve this problem, first we need to identify the reaction catalyzed by the enzyme…

Q: 1. Glucose synthesis was investigated in isolated hepatocytes. Different amino acids were added to…

A: Amino acids are building blocks of proteins which is consist of amine group, carboxylic group,…

Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- он…

A: Enzymes are the chemical substances that catalyse reactions by decreasing their activation energy.…

Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…

A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.

Q: Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively…

A: Mutations occur as a result of errors in DNA or viral replication, mitosis, meiosis, or other types…

Q: TIONS (Continued)

A: 5) Hydrololysis is a reaction in which reactant react with water and decomposition of water and…

Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…

A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…

Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…

A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…

Q: (d) ( through the disulfide bridge. If this bridge were found for the two joined amino acids free in…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Which of the following contain a correct first statement and an incorrect second statement? O…

A: Polyols have have several hydroxyl (-OH )groups in their structure. Hydroxyl groups make the polyols…

Q: Suggest, which enzyme pathway come into play

A: Phenylalanine is an aromatic and non-polar amino acid, it is both glucogenic (Fumarate) and…

Q: Question 6 A ceramide with a single sugar is called? Sphingomyelin Ganglioside Plasmalogen…

A: Ceramides : Waxy lipid molecules. It consists of the sphingosine and a fatty acid, within the cell…

Q: Many malignant tumors are characterized by the activation of one or more growth-factor receptors.…

A: Malignant tumours (or "cancers") are classified as monoclonal, which means that each tumour develops…

Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…

A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.

Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore…

A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while…

Q: Lysine is similar to ornithine. .Why does lysine not form a lactam? a. Infrequency of lysine…

A: A lactam is a cyclic amide (lactone+amide). A lactam antibiotic is an antibiotic that contains a…

Q: -Inhibitor +Inhibitor [S] (mM) V&ν βσπ:(μmol/sec) ν0&νβσπ: &νβσπ: (μmol/sec) 0.0001 33 17 0.0005 71…

A: Inhibitors are the substances that bind with enzyme and alter the km and Vmax values. Depending on…

Q: n the brain and muscles, in order for cytoplasmic NADH to insert its electrons int the electron…

Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).

A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…

Q: human blood plasma contains all the amino acids

A: here they are talking about amino acids present in blood plasma . so our blood plasma contains…

Q: A solution containing 3.58 x 1023 molecules/m3 of protein in water is separated from pure water by a…

A: Introduction: According to Fick's first law, the movement of particles from high to low…

Q: what molecules can prevent anabolic steriods form working?

A: Anabolic steroids are also known as anabolic adronergic steroid.This are binds to androgen receptors…

Question

100%

I having a hard time understanding this since the both template strand in the end is the same the G in 5' -3' and G 3'-5' is it possible to replicate it? Can you explain it? Thank you so much.

- CTGATICCG AA TG §
ACTIVITY 7.3.1
Given a part of DNA undergoing replication. Copy and write the
corresponding bases in the new strands. Put an arrowhead in the
appropriate end of each new strand to illustrate the direction of
growth.
P..GACTAAGGCTTAG
NEW STRANDS
CTGATICCGAATGS
3'... .
(Fill in the correct bases
and supply arrowheads.)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
What is the importance of complementary base pairing to DNA replication?
Explain in your own words why DNA replication is said to be semiconservative?
Describe in detail the semi Conservative replication of the DNA double helix structure
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
Explain the complexities of DNA replication that make the process (a) bidirectional and (b) continuous in one strand and discontinuous in the other.
4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
A seiee hserved under a microscope, researchers observe that the DNA is able to be SE be replicated. Based on this observation, which protein involved in DNA replication is most likely mutated? To answer the question please: I) draw a scheme of DNA replication; 2) name the proteins that are required for DNA replication; 3) propose the consequences of the process.
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
(e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable?
. Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase, (c) primase,and (d) ligase.