rotein kinase inhibitors have become a major focus for the development of molecularly targeted cancer therapies. Based on what you know from the development of Gleevec, what are at least two generalizable principles that apply to the development of all tyrosine kinase inhibitors? What is a potential pitfall of targeting a protein kinase for cancer treatment? (Relate back to Gleevec example - this answer should include three separate concepts – 2 principles, 1 limitation)
Q: Describe the mutational event that produces the MYC oncogene in Burkitt’s lymphoma. Why does the…
A: Burkitt lymphoma is a type of non-Hodgkin lymphoma that affects adults and children. NHL is a…
Q: Which base compositions for single-stranded RNA are possible? %A %G %C %T %U OA. All of the answers…
A: RNA are single stranded, their nucleobases donot participate in base pairing. According to the…
Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase…
A: Signaling is the process of communication between the cells, and between the cells and the…
Q: During the formation of the peptide bond which of the following takes place? a. Hydrogen atom is…
A: Between the α-nitrogen atom of one amino acid and the carbonyl carbon of another, a peptide bond,…
Q: Which of the following chromatographic techniques allows a faster elution of polar proteins? O…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: The terms isotonic, hypertonic, and hypotonic are typically used to compare the concentration of a…
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from…
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go…
Q: Please describe the biochemical processes involving hemoglobin and carbonic acid buffer system when…
A: Buffer solutions are extremely important in biology and is necessary for the maintenance of…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,…
Q: Enumerate the reagents used in extraction and isolation of RNA and their uses.
A: The purification of RNA from biological samples is known as RNA extraction. This method is…
Q: Fat storing cells of vertebrates are called hеpatocytes - asterocytes - adipocytes melanocytes
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, and…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…
A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…
Q: The transcription of a gene called YFG (your favoritegene) is activated when three transcription…
A: An enhanceosome is a group of trans-acting factors that assemble at an enhancer region of a gene to…
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2-…
A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: Functional group as indicated by letters A,B,C and D?
A: Tamiflu is a drug made from the starting molecule shikimic acid. Tamiflu is a prodrug usually used…
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: In the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each…
A: Ames test is performed to detect the ability of a chemical to cause mutation in the DNA. Histidine…
Q: One of the major problems in food chemistry is to make food gels maintain its shape and rigidity.…
A: Carrageenan are polysaccharides comprised of repeating disaccharide units of sulfate derivatives of…
Q: electrical conductivity
A: Given question is about electrical conductivity. The counterpart of electrical resistivity is…
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial…
A: From the above data, S1 = 0.0.3 mmol/L km is around 0.06 mmol/L Initial velocity V01 = 1.5*10-3 V0…
Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?
A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of…
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? O…
A: A protein is consisted of several amino acids bond together in sequence with peptide bond. To…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: Which of the following statements is NOT TRUE about tyrosine? O It is an essential amino acid. O It…
A: OPTION A: Tyrosine is a non-essential amino acid as the body makes it from phenylalanine. OPTION C:…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: Giveee a sufficient biosynthesis for this compound starting from acetyl CoA, S-alanine, S- adenosyl…
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep…
Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be…
A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle…
Q: Based on the figure and the explanation in the textbook, what are the random chances that the…
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124…
Q: Lysine is similar to ornithine. .Why does lysine not form a lactam? a. Infrequency of lysine…
A: A lactam is a cyclic amide (lactone+amide). A lactam antibiotic is an antibiotic that contains a…
Q: 17/18 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH2OH C=O…
A: Enzymes catalyse the reaction either by making or breaking the bond. They might form double bonds or…
Q: TRUE OR FALSE 1. In the structure of Aztreonam, addition of a moiety capable of Van de Waals…
A: Aztreonam is an antibiotic like penicillin and it inhibits the peptidoglycan crosslinking enzyme…
Q: In what subunits of ATP synthase are ATP molecules generated? 1. c subunits 2. gamma…
A: ATP Synthase: The use of proton motive force for ATP synthesis is catalyzed by ATP synthase. The ATP…
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that…
A: Proteins are present in their globular structure till they don't get denatured by something…
Q: Identifies the roles of ventilation and PCO₂ in acid/base balance . Answer ASAP .
A: Acid is present in body in stomach.Acid and base balence in body is important for human health.Acid…
Q: of sodium and potassium (that leads to hyponatremia and hypokalemia), hypocalcemia and ostcoporosis,…
A: In butler Albright syndrome Patients suffering from renal tubular acidosis, nephrocalcinosis, and…
Q: O antigen is a base oligosaccharide that is present in both A and B antigen. O True O False
A: The four blood types found in humans are A, B, AB, and O. Before undergoing a blood transfusion,…
Q: Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate…
A: The reaction given in the problem is the reaction between Pyruvate to Lactate conversion which is…
Q: Enumerate 10 examples of oxidation-reduction reaction that occur everyday.
A: Oxidation-Reduction reaction is also called redox reaction involves transfer of electron between two…
Q: A protein has the opnino acid seruence that cates as follows: •N-terminas - Some More amino kids -…
A: Protein targeting or also called as protein localization is the process by which proteins get…
Q: Glucolate is oxidized into Glvoxylate by cytechrome C using the glycolate oxidase enzyme. The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: Which of the following statements is TRUE for nonpolar amino acid residues of polypeptides or…
A: They are hydrophilic and found buried within proteins FALSE. Water soluble proteins contain…
Q: What amino acid residues interact with methylphenidate in DAT and NET protein active sites? please…
A: DAT and NET proteins are Dopamine Transporter and NET is Nor-Epinephrine Transporter proteins, both…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Question:-
Protein kinase inhibitors have become a major focus for the development of molecularly targeted cancer therapies. Based on what you know from the development of Gleevec, what are at least two generalizable principles that apply to the development of all tyrosine kinase inhibitors? What is a potential pitfall of targeting a protein kinase for cancer treatment? (Relate back to Gleevec example - this answer should include three separate concepts – 2 principles, 1 limitation)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question:- Explain how the analog-sensitive kinase mutant system allows identification of kinase substrates in a crude cell extract containing many different kinasesSuppose that Protein J which is a hypothetical protein kinase receptor was determined to be related to the progression of cancer through its activation. It was also determined that the protein exists in the active and inactive forms. The said active form is highly similar to the Protein K's conformation. Ligands A, B, and C, which are lead inhibitor compounds, were optimized to inhibit Protein J. The affinities of the ligands are shown in the table. Kp values Active Protein J Inactive Protein J Protein K Ligand A 10 mM 20 nM 5 mM Ligand B 20 nM 10 mM 15 nM Ligand C 20 nM 15 nM 15 nM Question: a. Which of the ligands, based on the table, has the highest specificity in binding to the target Protein J?Suppose that Protein J which is a hypothetical protein kinase receptor was determined to be related to the progression of cancer through its activation. It was also determined that the protein exists in the active and inactive forms. The said active form is highly similar to the Protein K's conformation. Ligands A, B, and C, which are lead inhibitor compounds, were optimized to inhibit Protein J. The affinities of the ligands are shown in the table. Kp values Active Protein J Inactive Protein J Protein K Ligand A 10 mM 20 nM 5 mM Ligand B 20 nM 10 mM 15 nM Ligand C 20 nM 15 nM 15 nM Question: a. Which of the ligands, based on the table, may be expected to be the most potent or have the highest activity against cancer? Explain. b. Which of the ligands, based on the table, may be expected to be least toxic to normal cells? Explain.
- Suppose that Protein J which is a hypothetical protein kinase receptor was determined to be related to the progression of cancer through its activation. It was also determined that the protein exists in the active and inactive forms. The said active form is highly similar to the Protein K's conformation. Ligands A, B, and C, which are lead inhibitor compounds, were optimized to inhibit Protein J. The affinities of the ligands are shown in the table. Kp values Active Protein J Inactive Protein J Protein K Ligand A 10 mM 20 nM 5 mM Ligand B 20 nM 10 mM 15 nM Ligand C 20 nM 15 nM 15 nM Question: Describe the relative binding affinities of Ligand A to Protein K and to the active and inactive forms of Protein J. Determine which will Ligand A bind with the highest, medium, and lowest affinity.Mutant tyrosine kinase signaling proteins are implicated in many types of human cancer. Hundreds of millions of dollars are required for the basic research and development of a new drug. Tyrosine kinase inhibitor drugs have been approved for cancer treatments by the U.S. Food and Drug Administration. What do you think would be some of the difficulties of finding these drugs given that similar kinases are active in normal cells? Do you think new medications of this type should be developed through government-sponsored research? Why or why not? If not, what alternatives do you propose?4. You develop the covalently-acting irreversible kinase inhibitor ibrutinib shown on the left that reacts potently with a cysteine in the ATP binding pocket of the cancer-promoting kinase Bruton's Tyrosine Kinase (BTK). You would like to know whether ibrutinib engages and selectively targets BTK in vivo in the tumor of a mouse model of cancer. Describe experimentally how you would use activity-based protein profiling to assess whether ibrutinib inhibited BTK in vivo in the tumor and also determine how selectively ibrutinib engaged BTK compared to other kinases in the tumor? ( NH₂ H₂N- ibrutinib OH OH OH OH OH activity-based probe for kinases that covalently modifies active-site lysine of all kinase ATP binding pocket L W ta to C с
- During an SAR effort to identify tyrosine kinase inhibitors, it was found that compound 2 was significantly more potent and selective than compound 1. To what might you attribute this improvement in activity and selectivity? Explain. IC-5 micromolar IC-0.1 mromolarI just read an abstract of the paper “Disulfide bond-disrupting agents activate the tumor necrosis family-related apoptosis-inducing ligand/death receptor 5 pathway” and noted that “DDAs and TRAIL synergize to kill cancer cells and are cytotoxic to HER2+ cancer cells with acquired resistance to the EGFR/HER2 tyrosine kinase inhibitor Lapatinib.” For the last sentence, I am not sure the meaning of the “acquired resistance to the EGFR/HER2 tyrosine kinase inhibitor Lapatinib”. Is the “acquired resistance ... to inhibitor” a good thing or bad thing, as far as the synergize effect of DDAs and TRAIL”? Hope that expert can help.Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that possess characteristics associated with normal stem cells, specifically the ability to give rise to all cell types found in a particular cancer sample. There are many biomedical engineering based approaches to detect CSCs. Question: What kind of systems have been developed to detect CSCs? Describe by giving examples. Please explain with a few examples.
- Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that possess characteristics associated with normal stem cells, specifically the ability to give rise to all cell types found in a particular cancer sample. There are many biomedical engineering based approaches to detect CSCs. Question: What is the importance and advanatge of detecting CSCs? Please explain in detailMore than 500 genes have been identified in the human genome that code for protein kinases. What does such identification imply regarding the role of protein kinases in cellular functions? Explain your answer.Cancer stem cells (CSCs) are cancer cells (found within tumors or hematological cancers) that possess characteristics associated with normal stem cells, specifically the ability to give rise to all cell types found in a particular cancer sample. There are many biomedical engineering based approaches to detect CSCs. Question: What is the importance and advanatge of detecting CSCs? Please explain in detail the main findings with your own words.