Show where trypsin and chymotrypsin would cleave the following peptide Tyr-Ile-Gin-Arg-Leu-Gly-Phe-Lys-Asn-Trp-Phe-Gly-Ala-Lys-Gly-Gin Gin
Q: A small peptide has two pKa values of 3.42 and 8.74. What is the isoelectric point for this peptide?…
A: Isoelectric point: The isoelectric point(pI) is the pH at which a particular molecule carries no…
Q: sample a peptide of known sequence was treated with trypsin; another sample of the same peptide was…
A: Protein sequence analyses are experimental methods that determine the amino acid sequence of a…
Q: Determine the net charge of the peptide below at pH 7 and 12. Show your solution.…
A: Given peptide sequence: Thr-Glu-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys At low pH, a peptide is…
Q: Determine the net charge (to the nearest integer) on the following peptide at pH5 AND pH 12.…
A:
Q: Reveal the secret message by writing the amino acid sequence into one-letter code: Leu-…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin.…
A: The following polypeptide is considered:…
Q: Which amino acid residue is preferred at which position in the following peptide for cleavage by…
A: While writing a polypeptide, the left side is the N terminus and the right side is the C terminus.
Q: The tripeptide +H3N-Leu-His-Glu-COO- has pKa values of 2.2, 3.6, 6.0 and 9.1. The isoelectric…
A: Isoelectric point (pI) is the pH at which there is no net charge on the molecule. For a amino acid,…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin,…
A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…
Q: NH, SH NH, он HN C. H,N HN PEPTIDE RNGCSN NH, PEPTIDE AHIKP
A: Trypsin is a serine protease that is found in the digestive system of vertebrates where it…
Q: Digestion of a peptide with trypsin generates two smaller peptide products: methionine-glycine and…
A: pepsin is a serine protease that cleaves the bond present in the C-terminal of amino acids Lysine…
Q: A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin;…
A: Trypsin is an endopeptidase. It is a serine protease that cleaves after the basic residues such as…
Q: Identify the sequence of the peptide below. H CH2 CH,…
A: The peptide bond is formed between carboxyl group of one amino acid and amino group of other amino…
Q: Which peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to…
A: Aromatic amino acids are relatively non polar. All aromatic amino acids such as tyrosine,…
Q: Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following…
A: Amino acids are the building blocks of proteins. The amino acid polymer which joins together with…
Q: Given below are sequences of amino acids present in an oligo-peptide chain. Count the overall charge…
A: Amino acids are the monomeric units that are used to form a peptide or protein and have chiral…
Q: Treatment of a polypeptide with 2-mercaptoethanol yields two polypeptides 1.…
A: Given that treatment of a polypeptide with 2 marcaptoethanol yielded 2 polypeptides: 1.…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: V-M-Y-F-E-N: This is the single-letter amino acid abbreviation for a peptide. What is the net charge…
A: Amino acids are biomolecules that join together by an amide bond to form a peptide molecule. The…
Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids. Question 2 options:…
A:
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…
A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…
Q: Consider the following peptide. Gly-Lys-Ala-Val-Asp-Gly-lle-Val-Lys-Ala-Gly-His-Glu-Ala a) What…
A: Since multiple questions are posted, only the first two are answered in this section, if you require…
Q: Write the chemical structure of peptide containing the following amino acid PRO-SER-GLY-LEU
A: Amino acids are building blocks of the protein molecule. There are twenty different amino acids. An…
Q: Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following…
A: An amino acid is a natural atom that is comprised of a fundamental amino gathering (−NH2), an acidic…
Q: Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1,…
A: Beta sheet is one of type of secondary structure in which inter strand hydrogen bonds is formed…
Q: H3N- CH-C CH-CH3 CH2 CH3
A: The net charge on an amino acid is determined by the pKa of the ionizable groups on the amino acid.
Q: Select the amino acid sequence that would most likely be located in the interior of a water soluble…
A: Peptides are composed of a linear chain of amino acid sequences attached to each other via peptide…
Q: Which of the following peptides would reach the positive electrode first if placed in an…
A: in a polyacrylamide gel electrophoresis, proteins are loaded in a vertical gel so that they can be…
Q: What is the net charge at pH 7 on a peptide with the following sequence?…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…
A: There are few agents that can digest the polypeptide chain.
Q: Draw a peptide from the given amino acids Phe-Cys-Ala-Arg-Ala-Ser-Tyr. Try to cleave this…
A: Pepsin has a broad cleavage specificity but has a greater propensity to cleave near hydrophobic…
Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…
A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…
Q: For a peptide with a sequence listed below. Lys-Gln-Val-Arg-Glu-Phe-His-Asn-Asp-Tyr 1) Estimate the…
A: Peptides are short strings of amino acids, typically comprising 2-50 amino acids. Amino acids are…
Q: HN H H H H H Se он
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: Identify and encircle the peptide bonds in this polypeptide (Asp-Sec-Leu-Cys-Glu).
A: Amino acids are compounds that contain amino as well as carboxylic acid groups. These are the…
Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: The melanocyte-stimulating hormone a-melanotropin has the following sequence:…
A: Aminoacids are the building blocks of proteins that are linked by peptide bond. The sequence of…
Q: Translate the following amino acid sequence into one-letter code:…
A: The unique one-letter code was developed for easy and fast recognition of amino acids. Each of the…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…
A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…
Q: Determine the kind of non-covalent interaction occuring between the side chains of the following…
A: Non-covalent interaction determines the shape of the macromolecules. There are four major…
Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…
A: Trypsin is a serine protease that is present in the digestive system of vertebrates. It is an…
Q: Draw a peptide for cys-asn- pro-gly (Using the same format in picture)
A: Proteins are the building blocks of life. Proteins are made up of amino acids. Amino acids when they…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…
Q: A peptide containing 18 amino acid residues in its sequence was partially hydrolyzed and peptides…
A: Amino acids are biomolecules which contains a basic amine group, an acidic carboxyl group, an…
Q: Discuss the 2 motor proteins associated with the MT in detail, but do not include structure.
A: Microtubules is a type of cytoskeletal protein that has specific role within the cell. Several…
Q: The bacterially produced antibiotic gramicidin A forms channels in cell membranes that allow the…
A: Antibiotics are molecules/compounds that have bacteriostatic or bactericidal effects. They are…
Step by step
Solved in 2 steps with 1 images
- Draw the peptide provided in its most protonated form. (Upload your answer.) Arg - Cys - Asp - ValTAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What are the Start and Stop codons in the mRNA?HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
- Give the correct names for the types of sugars shown below: a. b. CHO HO- -H € H- -OH CH₂OH HO- HO- HO- H- CHO -H -Ċ- -H -C-H -OH CH₂OHMet – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptideWhat is lac operan
- 1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VOHHH HHHH H H H HH -с-с-с-с-с-с-с-с-с-с-с-с-с HH H H H H H H H HHH H H H H H H H HHH H-C-O C-C- OH H H H H H H H H-C-0 C-C-C-C CH, H H H,CN-C-c-o-P-0-c-H CH, H H H H H H H H H c-c-c-o What do you call the structure enclosed in the rectangle? What type of chemical bond is represented by the structure with an arrow?. What structure does the bond identified in # 2 create in relation to the entire molecule shown? True or False: This molecule is non-amphipathic. (True or False) I-0-Idefine and explain unctions of Tra A, Tra D, Tra I, Ori T, relaxase
