Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript

Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript

Name: Select the events from eukaryotic transcription from the list below an
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Select the events from eukaryotic transcription from the list below and list them below in order,by letter, from earliest to latest during transcription.A. Sigma factor binds 5'TTGACA?'B. Rho separates DNA/RNA hybridC. TFIID binds TATA BoxD. RNA Pol

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Similar questions

E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answer
The partial sequence of a gene Question 2 coding strand is: 5'-TACGATCATAT-3. This sequence is transcribed. What is the sequence of the corresponding RNA? A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3’ C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5’ E 5'-TATACTAGCAT-3’
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
1 2 3' ACGACCAGTAAA 5' 9. How many codons are there above in question 8? Label one of them in green. 10. What event is coded for by UAA, UAG and UGA? 11. What is the start codon? 12.Describe the steps: initiation, elongation, termination, that occur during transcription. a. initiation b. elongation C. termination 13. What is the TATA box? 14. RNA processing, sometimes also called MRNA editing, occurs only in eukaryotic cells. Prokaryotic cells lack the enzymes to edit MRNA. The primary transcript is altered at both ends, and sections in the middle are removed.
(1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between transcription and replication (3) A DNA strand is 5' TAC ACG GTC TAA3' Write the RNA strand that could be made from the DNA strand. Indicate the 5' and 3' ends For each of the following, say whether they are DNA or protein Enhancer Transcription Factor Promoter RNA polymerase
Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" or
Based on your understanding of transcription, place the following events in the correct order. 1. A base pairs with U, and G with C 2. RNA released 3. RNA polymerase binds 4. transcription bubble 5. DNA polymerase grows new chain 6. A base pairs with T, and C with G 7. Promoter is reached O 3,4, 7, 5, 6, 1 O 5, 6, 3, 1, 2 O 7,3, 4, 6, 1, 2 O 3, 7, 4, 1, 2 O 5, 2, 4, 7, 1, 3
3 E D C The arrow in the diagram below indicates the direction of transcription. B A FFCAC CACTCAT Direction of synthesis- AUGCCCCAAUCUCUUCÉLÉRÉÚČÁÝU ATEC ATGCCGCA 4 TACGGCGTTAGAC с CL OA Which letter indicates the 5' end of an RNA strand? R Q Search F V T G SATE F6 6 B Y C H & 7 C N J Foto 99+ 8 F9 TACCACOTA ATGGTGCAT Sermont 9 30 54 MO O Alt E K2 L F P < F12 10:02 AM 4/8/2023 Ctrl 10
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..