Q: Give typed full explanation Which of the following results in the production of ATP from ADP? a.…
A: ATP is adenosine triphosphate which is the source of energy for the use and storage at the cellular…
Q: snail, the dominant allele N codes for right-handed shell coiling and recessive allele n codes for…
A: Genes exist in two versions namely"recssive" and "dominant". The recessive alleles are those that…
Q: Male and female pronuclei form Secondary oocyte present in oviduct Oocyte activation Meiosis…
A: A crucial biological process known as fertilization occurs when an egg cell containing genetic…
Q: correctly perform and interpret a proteomic analysis, careful attention of which of the following…
A: To conduct a proteomic analysis effectively and interpret the results accurately, several crucial…
Q: species, 30 Paramecia were found in 4 mL of sample pond water. At another location, 85 Paramecia…
A: We know that microorganisms are everywhere. Ponds are places where microbes thrive . Sometimes it's…
Q: Question 8 Glucose labeled with 14C at C5 is incubated with the glycolytic enzymes and necessary…
A: Glycolysis is the first step of cellular respiration that occurs in both presence and absence of…
Q: For each of the following, identify what characteristics of a species male and female karyotype…
A: Answers and Explanation : 1. Genic : In this case, the ratio of number of X chromosomes to the…
Q: Classify each specific inhibitor or inhibitor characteristic according to one of two types of…
A: Enzymes are biocatalysts that are made up of amino acids that means they are proteinaceous in…
Q: During an experiement, the value 0.0680 mg/ml was observed. The expected value is 0.75 mg in 90 mL.…
A: Answer : the value observed is = 0.0680 mg/ml the actual value is = 0.75 mg in 90 ml the actual…
Q: The term "gene expression" refers to the O process by which genetic information is transformed…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Zika virus is chiefly spread using an insect vector, more specifically, mosquitoes. Given this,…
A: Here, the correct answer is option d.) Climate change extends the habitat of mosquitoes that can…
Q: TAATTGE IGGAG anog regulatory sequence en this interaction map which DNA sequence would the…
A: Transcription regulation is a mechanism in which gene expression is regulated. For this purpose…
Q: *Cystic fibrosis is a rare autosomal recessive condition. A phenotypically normal man whose father…
A: Mendel proposed three laws based on his research. His research provided a picture of the independent…
Q: ATP energy for generates produce some produces many cellular work (a) (b) chemiosmosis has three…
A: Every living organism performs cellular respiration that is responsible for the breakdown of…
Q: If a recombination frequency cannot be above 50%, what does it mean if two genes are, say, 60 mu…
A: Recombination is a process by which two molecules of DNA exchange pieces of their genetic material…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…
Q: A pure breeding purple flower is crossed (mated) to a pure breeding white flower. The F1 offspring…
A: Incomplete dominance occurs when both alleles of a gene are only partially expressed at a location.…
Q: Molecules Toolbox: Glucose H₂O Outside of cell Na+ www 0₂ NaCl 1) Passive diffusion Amino Acid CO₂…
A: Passive transport -Against the concentration gradient( low concentration→high concentration)ATP(…
Q: Give explanation Which of the following statements is TRUE based on the phylogenetic tree shown?…
A: Phylogenetic trees function as graphical representations of the evolutionary connections between…
Q: The diagram below shows the normal sequence of a particular protein, along with several mutant…
A: Original Sequence: Met Gly-Glu-The-Lys-Val-Val- -ProMutant Sequence: Met-GlyMutation Description: In…
Q: Which level of protein structure involves a-helices, ß-sheets, and B- turns? a. primary b. secondary…
A: Protein structure refers to the way a protein's amino acid chain folds and organizes itself in three…
Q: Which of the following is not a property of homologous chromosomes? They pair physically during…
A: When a mother cell divides into two or more daughter cells, a parent cell has undergone the process…
Q: Why does the presence of double crossovers allow for underestimation of recombinant frequency?
A: The possibility of genetic recombination between 2 loci on a chromosome occurs during meiosis, and…
Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…
A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…
Q: A drug that inhibits the binding of CTLA-4 to CD86 will help in immunotherapy for malignant melanoma…
A: Lymphocytes are a type of white blood cells that play a major role in immunity. Lymphocytes provide…
Q: It is possible to treat addiction by prescribing drugs that block the effects of the psychoactive…
A: Agonists are the drugs which attach to the receptor generating an identical response to the…
Q: Which of the following levels of organization is arranged in the correct sequence from most to least…
A: Ecosystem: An ecosystem is a broader concept that encompasses both living (biotic) and non-living…
Q: Name and describe 5 properties of cancerous or tumor cells from patients(in vivo) and of cancerous…
A: Cancerous cells are abnormal cells that grow uncontrollably, invade surrounding tissues, and can…
Q: What is the differences and similarities of mitosis and meiosis? Explain in 1-2 sentences
A: Cell division is a process in which a parent cell divides into daughter cells. There are two types…
Q: What is the relationship between an increase in fossil fuel consumption and increased carbon in…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: 6. What volume of a 9% NaCl solution is needed to prepare 100 mL of a 0.9% NaCl solution?
A: The serial dilution process is routinely performed in the biology laboratories to calculate the…
Q: In a dihybrid cross for which the parental cross is A/A;B/Bx a/a;b/b, what proportion of F2…
A: In a dihybrid cross between A/A;B/B (parent 1) and a/a;b/b (parent 2), you need to consider the…
Q: Calculate allele frequencies in a population of 200 dominant homozygotes (TT), 50 heterozygous (Tt)…
A: Allele frequency is a way of describing, how common the allele is in a population.
Q: lucose enters erythrocytes via a uniporter. As the levels of glucose in the bloodstream decrease…
A: Upon entering erythrocytes (red blood cells) through the GLUT-1 uniporter, glucose undergoes…
Q: 13. Three batches of radish seeds, 100 seeds each, were placed in Petri dishes and provided only…
A: The process through which a plant transforms from a seed into a seedling is called germination.…
Q: What aspect of chromosome behaviour most clearly accounts for Mendel's law of segregation?…
A: Ans.Mendel's law of segregation states that each parent passes one allele for each trait to its…
Q: The doctor orders 3 mcg/kg/min of sodium nitroprusside. The stock supply is 100 mg of sodium…
A: Sodium nitroprusside is used in medication to manage acute hypertension. It is a potent vasodilator…
Q: transferred
A: If only one half of the flora in the world existed in 2110 (perhaps due to deforestation), it would…
Q: Which of the following concept maps correctly describe the relationship among these four terms -…
A: Genomic is field of study which is used in order to comprehend the structure as well as the function…
Q: Explain all point of question with proper answer.
A: Living organisms contain DNA (deoxyribonucleic acid) as the genetic material that is present within…
Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…
A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…
Q: In many types of tumors, the genomic DNA methylation pattern is changed either through…
A: Out of the options listed in the question, most promising potential cancer therapy that can restore…
Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula
A: The development of an organism begins after the fertilization process. Fertilization involves fusion…
Q: The ancestors of seed plants are thought to have been heterosporous. In modern day gymnosperms,…
A: Algae are the first photosynthesizers to arrive. Later on algae helped in the development of new…
Q: Peripheral membrane proteins may noncovalently interact with phospholipid heads O contain many…
A: Peripheral membrane proteins display distinct features:Potential Noncovalent Interaction with…
Q: in glycoproteins, carbohydrate is most often linked to Threonine, asparagine, or a) serine b)…
A: Carbohydrates are linked to asparagine in glycoprotein. This linkage is called as the N-linked…
Q: Oligotropication nutrient loading. Group of answer choices с True can lead to dead zones because of…
A: In the world of water, where streams flow and creatures swim, there's a delicate balance, like a…
Q: In lab this week, you will draft a methods section of a report in your worksheet with your team.…
A: The question is about the key components that should be included in the methods section of a…
Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG
A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…
Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…
A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…
Step by step
Solved in 3 steps
- 3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the MRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the mRNA sequence be? Explain your answer and label all strands. A. First letter of codon…1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队 相阳阳一即即的 9 First letter…
- 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
- A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|1.) if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of nucleotide base pairs needed to code for B-globin? 1a.) How many mRNA codons does this correspond to?5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
- 30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?