
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question

Transcribed Image Text:Which codons do not have a matching tRNA? Select all that apply
O UAA
O AUG
O UGA
UGG
OUAG
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can you help me solve this sequence question and identifty the mutation?arrow_forwardWhat amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met for anticodon UAC]arrow_forwardSuppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:arrow_forward
- Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…arrow_forwardSARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/Aarrow_forward5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13arrow_forward
- What aminos acid would the anticodon GAC be translated into? Please explain how you went about getting to the answer to the question.arrow_forward41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acidarrow_forwardUsing the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education