Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as depression. The presence of two or more diagnoses is known as

Q: Which is NOT a question that science can answer: (a) Does taking ginkgo reduce the chance of Alzheim...

A: * Gingko biloba is an extract that is obtained from leaves of the Ginkgo biloba tree. * It is believ...

Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne...

A: Permutation infers the maximum number of possible arrangements by given things/ variables that can b...

Q: One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes a...

A: The fruit fly's color of the eye is further controlled by the autosomal locus. The given fly compris...

Q: female nurses in their forties who don't drink with

A: Vaccine:  It is substance which triggers the bodies immune system against a particular disease.  

Q: 10n: Frans de Waal found that when they differentially rewarded Capuchin Monkeys for the same task, ...

A: The capuchin monkeys are New World monkeys belonging to the subfamily Cebinae. They are not good pet...

Q: Differentiate vasculogenesis from angiogenesis. Explain why blood vessels degenerate as well as the ...

A: Vasculogenesis is the process of blood vessel formation from endothelial progenitor cells. Angiogene...

Q: Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine...

A: 13 -correct option is - b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Ur...

Q: Hardosaurs like edmontosaur the front feet do they have name or description how they look? It looks ...

A: The comb-crested hadrosaurid (duck-billed) dinosaur Edmontosaurus regalis is a species of comb-crest...

Q: normal microbiota

A: Microbiota can  refer to all the microorganisms found in an environment, including Bacteria, viruses...

Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral sequenc...

A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and...

Q: Onions leaves have been modified for the purpose of _______ Defense (protection from predators) Sto...

A: ✓The scales of the onion bulb are actually modified leaves that provide protection from water loss(i...

Q: Differentiate vasculogenesis from angiogenesis

A: Vasculogenesis- vasculogenesis is the de Novo synthesis of blood vessel. It leads to the development...

Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...

A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts,  *out...

Q: Which of the following terms is related to cladistics?

A: Cladistics is a system of biological taxonomy that defines taxa uniquely by shared characteristics n...

Q: 3) Analysis of the sequence of a DNA fragment shows the presence of restriction site for the enzyme ...

A: The restriction site is the site which is a type of specific genetic sequence present on the DNA fra...

Q: Amanda is a 42-year-old female diagnosed with type 2 diabetes. She feels that it was only a matter o...

A: Diabetes is an ailment that happens while the level of glucose in your blood (blood sugar) is simply...

Q: e strongest force that caause plate movement is

A: Thermal convection is a force which is caused by the heat of the interior of the earth. Hot currents...

Q: Explain some of the ways genes may interact to affect the phenotype and discuss how a single gene ca...

A: ANSWER:  Some of the ways by which genes may interact to affect the phenotype are mentioned below:  ...

Q: The study by Wakefield et al. that purported to show a link between autism and the MMR vaccine was p...

A: Answer-  (d) All of the above

Q: O) n an animal cell, under aerobic conditions., what molecule(s) will pyruvate be converted into nex...

A: Pyruvate is formed by glycolysis in cytoplasm. The main function of pyruvate is to serve as the tran...

Q: Is the blood in motion or not in motion after an activity?

A: Our blood is carried to different organs by the arteries continuously. The heart pumps the blood (ox...

Q: Meiosis_______ . a. occurs only in animals b. supports growth and tissue repair in multicelled  spec...

A: Meiosis is a cell division that forms four progeny cells from a single parent cell.  

Q: TOPIC: The response of an HIV strain to antiviral drugs. Research your specific example of natural s...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image? ...

A: Nucleic acids are genetic molecules that transfer and store information in cells at the molecular le...

Q: Plant roots develop differently from plant shoots during primary growth.  Explain: How is the forma...

A:   Introduction  Plants undergo primary growth to increase length.  It is result of rapid cell divisi...

Q: How many N-terminus are there in this cartoon?

A: *There are four types of protein structure are present. primary structure secondary structure terti...

Q: A group of closely related strains, not all identical *         a. class       b. specie       c. no...

A: A strain is a genetically different variety, a subtype within a biological species. Nomenclature is ...

Q: Poly-A chain would produce what type of amino acid chain?: Is it Poly-Alanine, Poly-Arginine, Poly-A...

A: Poly A tail is added to the mRNA molecule for enhancing the stability of the molecule during process...

Q: A collection of similar phyla or divisions *       a. family       b. order       c. kingdom       d...

A: 1. A collection of similar phyla or divisions-  c. Kingdom Kingdom: In biology, a kingdom is the se...

Q: Define linkage and relate it to specific events in meiosis.

A: If two alleles of genes are located close together on the same chromosome, both the genes will be pa...

Q: Match the rodent ovulatory cycle phase with the correct hormone combination Proestrus x Peak Progest...

A: The term menstrual cycle is associated with the occurrence of cyclic ovarian activities in mammals. ...

Q: Coat color of dogs depend upon the action of at least two genes. At one locus a dominant epistatic i...

A: There are some important points: We know that genes are functioning independently on each other and ...

Q: 3. What is the difference between the compound light microscope and the stereo microscope? (1 Point)...

A: Compound microscope A compound microscope is commonly used to view something in deta that we can't ...

Q: Use an example to describe tumor suppressors

A: Cancer is the state of uncontrolled cell division that has some genetic factors.

Q: Procedure A Take 3 ml Add 50 ul of Top up to 50ml. - Add fresh LB Mix Sml ampicillin to the overnigh...

A: We can test the antimicrobial resistance of any strain of bacteria by exposing the bacteria to that ...

Q: dentical a. class b. specie c. nomenclature d. strains 2. A group of morphologically similar organis...

A: 1)Ans-  D)strains Explanation-  A strain is a defined as group of designated offspring that are eith...

Q: What is transpiration

A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...

Q: How is the concept of norm of reaction related to the lack of yellow hydrangea flowers illustrated i...

A: Hydrangea also know as hortonsia it is a genus of over 75 species of flowering plants in native to A...

Q: Aside from outer pinna, what structures do mammals have in their ears that reptiles and birds do not...

A: * pinna  is absent in many mammals and  this organ acts as a heat dissipator but not involved in hea...

Q: Why do blood vessels degenerate during organogenesis? What is the significance of this degeneration?

A: In human body blood vessels helps in the  delivered of blood to the organs and tissues in our body. ...

Q: Which of the following statements about nutrient challenges faced by organisms is FALSE? Carnivores ...

A: There are various nutrient challenges faced by organisms in their environment. 

Q: Show how data from a two-point test cross can be used to distinguish between independent assortment ...

A: Linkage is the tendency for a pair of genes on the same chromosome to be transmitted down to subsequ...

Q: 3. Red-green color blindness (b) is a recessive sex-linked trait. A colorblind male marries a normal...

A: * Red-green color blindness is also called as deuteranopia. * The affected individuals having this t...

Q: Gather data about the mammals, an organism from the animal kingdom, from its classification system, ...

A: Taxonomy is the systematic classification of living organisms into groups or categories based on pre...

Q: VP Indole (+ or -) Organism Gram Cll EMB Catalase MSA Oxidase (+ or -) (+ or -) (growth/ characteris...

A: * The bacteria is divided into two types based on gram staining Gram positive Gram negative. * The...

Q: 2. How should the following patients be identified? a. siblings or twins b. newborns C. common names...

A: Identification is essential in both civil and criminal cases in living persons (cases like divorce, ...

Q: What is sumoylation and how does it affects newly synthesized proteins?

A: SUMOylation :- It is a post translational modification that is involved in various cellular process....

Q: What principle is involved in the isolation of albumin?

A: Albumin is protein that is made by the liver, Albumin helps to Keep fluid in the bloodstream. It car...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: 4. Characterize the following human chromosomes as to size and as to position of its centromere. Typ...

A: Chromosomes are thin structure present inside the nucleus which consists of DNA , proteins and most ...