Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcript? A. 3'- GCGAAUAUUAGCAAUGCUGCCGUUAAUGCCCUAAGGAGCG CUUU - 5' B. 3'-AGCAAUGCUGCCGUUAAUGCCCUAAGGAGCGCUUU - 5' C. 3'-AGCAAUGCUGCCGUUAAUGCCCUAAGGA - 5' D. 3'-AGCAAUGCUGCCGUUAAUGCCCU -5'

Q: 1. What is/are the importance of testing Rh blood type in the laboratory? 2. Why is Rh system deter...

A: The Rh blood group is discovered by the Wiener and landsteiner.This Blood group system is based upon...

Q: Chimpanzees, bonobos, and orangutans cannot speak like us because A: They are too stupid. B: Their a...

A: Speech is a communication that is used to express our thoughts in words. 

Q: 3. Red-green color blindness (b) is a recessive sex-linked trait. A colorblind male marries a normal...

A: * Red-green color blindness is also called as deuteranopia. * The affected individuals having this t...

Q: TOPIC: The response of an HIV strain to antiviral drugs. Research your specific example of natural s...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: What are the current trends and innovations in International Blood Bank Laboratories?

A: Recent innovations in the field of Blood Bank Laboratories are:- Blood Bank Information System: - C...

Q: Which phase of meiosis reduces the chromosomenumber?a. prophase I c. anaphase Ib. prophase II d. ana...

A: Meiosis is a process where a single cell divides twice to produce four cells containing half the amo...

Q: What will be the effect of macronutrient deficiency on plant growth and development

A: Macronutrients are of two types primary and secondary macronutrients. Primary macronutrients are nit...

Q: Explain Mendel’s principles of segregation and independent assortment, given what scientists now kno...

A: Mendels is meterologist who discovered principles of heredity by doing experiment on pea plant. Also...

Q: Describe the role of microtubules in nuclear division.

A: A microtubule is a type of filament present in the cytoskeleton.

Q: Conduct research and summarize the causative agent and mode of transmission behind the multistate me...

A: The inflammation that is occurring on the meninges membrane around the brain is called meningitis. M...

Q: Onions leaves have been modified for the purpose of _______ Defense (protection from predators) Sto...

A: ✓The scales of the onion bulb are actually modified leaves that provide protection from water loss(i...

Q: normal microbiota

A: Microbiota can  refer to all the microorganisms found in an environment, including Bacteria, viruses...

Q: 1. Modifications of seaweed hydrocolloids changes its chemical properties and functionality. What ar...

A: Seaweed hydrocolloids are thickening or gelling substances and are mostly used in the food industrie...

Q: 6.) What happens to your body and homeostasis when you work out? a.)You start to shiver to warm the ...

A: Maintainenance of Homeostasis  is very important for normal functioning of the body.

Q: Explain some of the ways genes may interact to affect the phenotype and discuss how a single gene ca...

A: ANSWER:  Some of the ways by which genes may interact to affect the phenotype are mentioned below:  ...

Q: Which of the following statements about nutrient challenges faced by organisms is FALSE? Carnivores ...

A: There are various nutrient challenges faced by organisms in their environment. 

Q: Gather data about the mammals, an organism from the animal kingdom, from its classification system, ...

A: Taxonomy is the systematic classification of living organisms into groups or categories based on pre...

Q: In the case of the bacterial two-Na+/one-leucine symporter, what is the key distinguishing feature o...

A: The six oxygens of the primary carbonyl or  secondary carboxyl groups that bind each of the transpor...

Q: Biologists assign each organism on Earth to a species containing similar organisms.  Related species...

A: Classification is the process to arrange and categorizing organisms into group which is based on rel...

Q: Transmission of a nerve impulse across a gap between neurons is due to: a) Movement of a molecule, a...

A: Transmission of nerve impulse takes place jn brain as a result of stimuli. They are transmitted from...

Q: Which of the following have a four chambered heart? Choose all that apply. snakes & lizards crocodil...

A: Heart is divided into various chambers depending on the types of blood it contains like oxygenated b...

Q: What are the differences of yeast from other kingdom?

A: Yeast is a single-celled creature known as Saccharomyces cerevisiae that requires food, warmth, and ...

Q: Procedure A Take 3 ml Add 50 ul of Top up to 50ml. - Add fresh LB Mix Sml ampicillin to the overnigh...

A: We can test the antimicrobial resistance of any strain of bacteria by exposing the bacteria to that ...

Q: Which of the following statements is incorrect? a. Some gene expression patterns can be passed to an...

A: The epigenetic regulation of gene expression is considered a very common process. This plays a major...

Q: Which of the following are amniotes? Choose all that apply. Fish O Amphibians O Reptiles Birds Mamma...

A: This specialised membrane structures of certain tissues formed outside of the body of the embryo whi...

Q: Based on the figures given, 1. What range of time and temperature combinations poses the highest ri...

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...

Q: Is genetic engineering a pure scientific process or it is indeed an act of humans playing like God?

A: Genetic engineering is a process by which the nature of genetic material (DNA and RNA) is altered an...

Q: Remember that although there are many interesting ideas about genetic engineering of plants and anim...

A: Transgenic bacteria are bacteria whose genome contains genes from other organisms that have been del...

Q: Aside from outer pinna, what structures do mammals have in their ears that reptiles and birds do not...

A: * pinna  is absent in many mammals and  this organ acts as a heat dissipator but not involved in hea...

Q: Which of the following processes involve random (chance) events?

A: The answer is all of the above. All the events as given,Genetic drift,Genetic recombination by cross...

Q: Hand drawing of a forest ecosystem foodchain

A: Introduction: A food chain is a linear sequence if organisms representing producer to top consumer o...

Q: Which pioneers of microbiology had the biggest impact on surgical patient care?

A: Introduction:- Microbiology always helps us to create numerous medical advancements in terms of unde...

Q: Which of the following is TRUE about CAM photosynthetic pathway? Compared to the C3 and C4 pathways,...

A: * CAM photosynthetic pathway also called  Crassulacean acid metabolism photosynthetic pathway. *CAM ...

Q: What is brackish water? ocean water water with little or no salt in it (fresh water) water that cont...

A: Brackish water is the water found in natural environments that is more saline than freshwater but le...

Q: are my answers correct?? there were blank spaces

A: The DNA consists of 4 nitrogen bases which are Adenine (A), Thymine (T), Guanine (G), and Cytosine (...

Q: Red-green color blindness is inherited as a sex-linked recessive trait. The gene is found on the X c...

A: The answer is he can't(unless there is a mutation )

Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...

A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...

Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...

A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl-  co transport...

Q: Describe the purpose of cell cycle checkpoints.

A: Introduction  The cell cycle is controlled by various internal and external factors such as the amou...

Q: Which of the following are jawless? Choose all that apply. O hagfish O lampreys O bony fishes O cart...

A: Jawless organisms are belongs usually to class Agnatha and primitive in nature. 

Q: If you have 7 large DNA duplexes, how many TOTAL DNA duplexes will you have after 7 rounds of PCR (i...

A: * PCR or polymerase chain reaction is chemical reaction  used to amplify the pieces of DNA. *Hence B...

Q: VP Indole (+ or -) Organism Gram Cll EMB Catalase MSA Oxidase (+ or -) (+ or -) (growth/ characteris...

A: * The bacteria is divided into two types based on gram staining Gram positive Gram negative. * The...

Q: rections: Answers must be in essay form. Outline form is not acceptable. Labeled diagrams may be use...

A: Introduction: In the process of fermentation, the NADH produced during glycolysis will be recycled b...

Q: Certain proton pump inhibitors that inhibit secretion of stomach acid are among the most widely sold...

A: H2 blockers or histamine H2-receptor antagonists are drugs that minimize the acid production in the ...

Q: Base on the data below, what type of lipid is being present in the sample?

A: A lipid is any of various organic compounds that are insoluble in water.. Some lipids are -- include...

Q: What effect do sodium, caffeine, and alcohol have on calcium levels in the body?

A: The human body is made up of everything that makes you, you. Our genetic information determines and ...

Q: Given the DNA of the three organisms, determine the mRNA, IRNA, and the amino acids that correspond ...

A: There are 64 possible codon for four nucleotides out of 64 codon 61 code for Amino acids and 3 do no...

Q: In Drosophila melanogaster, a yellow-bodied (dark coloured) male with vestigial (underformed) wings ...

A: Drosophila malenogaster is a fruit fly from family drosophilidae. 

Q: rections: Answers must be in essay form. Outline form is not acceptable. Labeled diagrams may be use...

A: Introduction: NADH is essentially produced only during the cellular respiration and it gets oxidised...

Q: How does the translated mRNA convert into a functional protein?

A: Translation is a process in which cells make the proteins.