Return whether the pattern was found or not (found), the number of times the pattern was found (n), all starting positions at which the pattern was found (positions) and the number of comparisons.""" Given text: CAGTCAGTCATCATGCGTATCAGCTGATC  TATCGGGCGCGCGCGTATCATC Combinations to look for: TGCGTATCAGCT CGCGCG TAT GTCA

Q: Write a function named slice_it (numbers_list, index) that takes a list and an integer as…

A: - We have to code the slice function.

Q: lef cost_to_hike_naive(m: list[list[int]], start_point: tuple[int, int], end_point: tuple[int, int])…

A: Answer: I have done code in python and also I have attached code as well as code and output.

Q: In this task, we will develop a program to detect whether a target number is the sum of k elements…

A: Here is the python code. See below step for code.

Q: withoutusing

A: To program : Copying one string to other but without using any predefined function. Program…

Q: How do you create a a python program that implements the following functions…

A: Actually, python is a easiest programming language. It is a platform independent.

Q: Statistics After the simulation, you will prepare and return these stats on your village's parties:…

A: Description The 4 main functions are defined in the next step: unheard_songs() billboard_top()…

Q: The program is the same as shown at the end of the Merge sort section, with the following changes:…

A: Step1: We have create a function read_num()  Step2: Then we have print_nums function that takes…

Q: You have a Positional List sorted in ascending order and a Stack sorted with the smallest element at…

A: Given The answer is given below.

Q: How do I code this on python heres the problem  Use the Design Recipe to define a function…

A: Programming instructions: Define the function count_value which takes the list and a value as an…

Q: t creates a new string from the original string s by removing all instances, if any, of the st…

A: Here have to determine about remove_substring_from_string function in python.

Q: Write a Python program that takes a list as an input from the user.Then creates a new list excluding…

A: Input the numbers and split it lo list Convert each number from string to integer Check the length…

Q: Problem Statement: Remove duplicate values from list In this lab, you will be building a software…

A: """Application that remove the duplicate values from the list""" #user define function to perform…

Q: Problem: Based on your transcript grades; you are required to do the following: 1- A prompting…

A: Step 1: Import the necessary modules: turtle and numpy.Step 2: Set up the Turtle graphics…

Q: please code in python  Forbidden concepts: recursion, custom classes Create a program that finds…

A: Find the code below

Q: NEED HELP PYTHON PROGRAMMING ONLY SORTING AND SEARCHES (CODE GIVEN AS WELL) Start with the code…

A: Import necessary libraries: Import random and time libraries to generate random numbers and measure…

Q: Using the C programming language implement Heapsort in the manner described in class. Here is some…

A: Heap sort : Heap sort is a comparison-based sorting technique based on Binary Heap data structure.…

Q: For this week python assignment your task is to computer the queries in X Y z format where you are…

A: 1. Input m, q and the list 2. Now run a loop q times and in each iteration input x,y,z         2.1.…

Q: Python code: There are 51 Electoral College races (50 states plus the District of Columbia) so we…

A: Algorithm: Start Declare an empty list coinFlip Iterate through the loop from j=0 to j=50 Generate…

Q: 3. (6 points) You have a list called Ist which contains numbers. You want to use the index method to…

A: Here have to determine python code for fill in the blanks.

Q: code in C++ and code new part of program added to bottom. Using the sample BUBBLESORT program

A: Program Code:   #include <iostream>using namespace std; void bubbleSort(int array[], int size)…

Q: Please answer the ques with showing the code: (There is only 1 ques with 2 steps ) Q1: Step 1:…

A: NOTE: As per the company rules we are supposed to answer only first question please post your…

Q: splice_rna (dna, intron_list) This function should accept a string representing a DNA sequence and a…

A: Python which refers to the high-level, general-purpose programming language. Its design philosophy…

Q: Ok I need some help as regards to the following task python code using pandas Expand multiple days…

A: The provided code is a Python script that involves data manipulation using the pandas library. It…

Q: What is the output of the following python code? nameList = ['Oman', 'Qatar', 'Bahrain', 'Emirates']…

A: Programming code in Python: nameList = ['Oman', 'Qatar', 'Bahrain',…

Q: This is to use Python  I create a list withe the building names 'Richard Weeks Hall’, ’Busch Student…

A: Following is the python program:Approach: create a list to store the names of the building. using…

Q: Develop an algorithm to calculate the average of the elements of a list x. Implement your algorithm…

A: Program Plan: Define calculateAverage() function that calculates the average of the list. Input the…

Q: Write a program to test various operations on a binary search tree.

A: C++ working Code for Pre, Post, and Inorder and delete function: #include <iostream> #include…

Q: Python: if possible answers in one line of code def name_sort(staff):     '''     Question 2…

A: Editable Source Code: def name_sort(staff):    staff.sort(key=lambda x: x.split()[1])    staff =…

Q: Give the index of the pivot value after the whole list below has been partitioned using the…

A:

Q: Task 9 Write a Python program that reads 10 numbers into a list and prints the numbers of that…

A: Python program to take list elements as input from the user and removing all even elements from the…

Q: Question: Consider a hash table to size 10. Write a program by using quadratic probing and insert…

A: Quadratic Probing: Quadratic probing is an open-addressing scheme where we look for the i2‘th slot…