splice_rna (dna, intron_list) This function should accept a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. splice_rna[] should return a protein string that results from transcribing and translating the exons of the given string. [HINT: You should use some of your previous functions. It's similar to the last part of labo3.] Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG" Sample intron list:

splice_rna (dna, intron_list) This function should accept a string representing a DNA sequence and a list of strings representing introns. The process of transcribing DNA into RNA involves translating the DNA to RNA and then performing RNA splicing, where the sequence is chopped into smaller segments called introns and exons. Introns are segments of the gene not used for protein translation, so they should be removed from the sequence. Exons are the remaining segments, which are then transcribed sequentially into a protein string. splice_rna[] should return a protein string that results from transcribing and translating the exons of the given string. [HINT: You should use some of your previous functions. It's similar to the last part of labo3.] Example: Sample input DNA string: "ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG" Sample intron list:

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter5: Repetition Statements

Section5.4: For Loops

Problem 7E: (Conversion) Write a C++ program to convert kilometers/hr to miles/hr. The program should produce a...

See similar textbooks

Similar questions

Python code The function takes two inputs: a number and a list, and returns a list of indexes where the number can be included in the list, as well as a -1 if the number cannot be found in the list.
Define the term additional string operations.
File System: It is highly useful in file system handling where for example the file allocation table contains a sequential list of locations where the files is split up and stored on a disk. Remember that overtime it is hard for an OS to find disk space to cover the entire file so it usually splits these up into chunks across the physical hard drive and stores a sequential list of links together as a linked list. Write an algorithm for the above problem and analyse the efficiency of the algorithm.
Data structures return_growing_num_list(max:int) -> list This function will be given a single number, it should return a list of strings of numbers. Each string in the list will only contain a single number repeated an arbitrary amount of times. The number each string will contain will be equal to the current string's index+1. The number in the string should be repeated the same number of times as the string's index+1. Each number in the string should be separated by a space. This list should stop when its size equals the max number specified. Example: max = 3 output = ['1', '2 2', '3 3 3'] max = 4 output = ['1', '2 2', '3 3 3', '4 4 4 4']
Computer Engineering Lab QuestionAssume you are working at Jhonson Research Laboratary, to develop a cure for Covid19 virus you have to find the RNA sequence for the given DNA sample of the rat. Your task is to develop a Perl code to convert the given DNA into RNA. Assume that the DNA sequence of the test rat is “GATTACACAT”
(Conversion) Write a C++ program to convert kilometers/hr to miles/hr. The program should produce a table of 10 conversions, starting at 60 km/hr and incremented by 5 km/hr. The display should have appropriate headings and list each km/hr and its equivalent miles/hr value. Use the relationship that 1 kilometer=0.6241miles.
Programming Language: C++ Provide some explanation about the code and the loop pls.
Number Analysis ProgramDesign a program that asks the user to enter a series of 20 numbers. The program shouldstore the numbers in a list then display the following data:• The lowest number in the list• The highest number in the list• The total of the numbers in the list• The average of the numbers in the list (in python)
Vocabulary Task (C language) please also include how to create a txt file and where will it be saved in the computer Natural language processing (NLP) is a field of artificial intelligence that seeks to develop the ability of a computer program to understand human language. Usually, the first step of an NLP system is to convert words into numeric codes. Thus, the system converts an input text into a sequence of numeric codes before any high-level analysis. This process is known as text preprocessing. We can only perform text preprocessing if we have a vocabulary of words and their associated numeric codes. Your task is to create a vocabulary of unique words for a given text file and assign a different number from 1 to N to each unique word, with N being the total number of unique words. You must perform this assignment so that the first word in alphabetical order gets the number 1, the second word in alphabetical order gets the number 2, and so on. A word is a sequence of letters…
www Using c++ in sfml make an login interface • Has two button one for child and other for parents after clicking on it, it will appear a new page to put a username and password
String Concate Operations
Computer science What are the advantages of using a link list instead of an array?