How many more genes in the plasmid (besides the insulin cDNA insert) are need to determine which bacterial cells have been transformed and to determine which transformed bacterial cells have a plasmid with the cDNA insulin insert? Prior to the ability to produce human insulin in bacteria, insulin was harvested from pig or cow carcasses. A visiting veterinarian told me that domestic cats did better on the “old insulin” than on the genetically engineered human insulin. How might a comparison of the amino acid sequences of cats, pigs, cows, and humans support or fail to support this claim? What is needed in the plasmid with the cDNA insert besides the gene for insulin to actually cause the bacteria to express the insulin gene and produce the insulin protein?

How many more genes in the plasmid (besides the insulin cDNA insert) are need to determine which bacterial cells have been transformed and to determine which transformed bacterial cells have a plasmid with the cDNA insulin insert? Prior to the ability to produce human insulin in bacteria, insulin was harvested from pig or cow carcasses. A visiting veterinarian told me that domestic cats did better on the “old insulin” than on the genetically engineered human insulin. How might a comparison of the amino acid sequences of cats, pigs, cows, and humans support or fail to support this claim? What is needed in the plasmid with the cDNA insert besides the gene for insulin to actually cause the bacteria to express the insulin gene and produce the insulin protein?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
How many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type IIl restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. 1 2. 4. 5.
Choose the false statement. O Genetic engineering includes recombinant DNA techniques whereby DNA is hydrolyzed at specific sequences, pasted back together with ligase, and then inserted into cells of interest. O GMOS are organisms that, if eaten as a nutrient source, can genetically modify our DNA. OBacterial cells that have been transformed with the engineered plasmid can be selected for by utilizing antibiotics in the media and adding a drug resistance gene to the plasmid.
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
A target gene for producing human insulin must be inserted into a plasmid before the transformation process. Why the plasmid is important in this process? * I The target gene lacks the ability to replicate itself. II Screening process will be difficult without cloning vector. II The host cell is able to accept the recombinant plasmid but not the non- recombinant plasmid. O I and Il only I and III only O Il and III only O I, Il and III
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Antisense RNA If MRNA is produced using this plasmid, what changes would result in production of an antisense RNA? Gene A Promoter McGraw-Hill Educston Check All That Apply No change is necessary because the MRNA Is the antisense RNA. The promoter must be moved to the other slde of Gene A. The antisense DNA must be Inserted Into the plasmid. Reverse the direction of Gene A In the plasmid.
The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.
Which of the following computational tools would you use to determine the amino acid sequence encoded by your expression plasmid insert sequence? Protein Blast ExPASy Translate ExPASy pI/Mw T-COFFEE
You wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 1