QUESTION 3 Methyl groups are added to histones by. O A. histone deacetylases B. histone methyl transferases C. nucleosome remodeling complexes D. histone acetyl transferases E. DNA methyl transferases
Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…
A: Answer- Option D. 5' TAGTGACAGTTGCGAT 3¹
Q: QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very…
A: Nucleotide excision repair (NER) is the main pathway used by mammals to remove bulky DNA lesions as…
Q: Question 8 Modification of histone proteins include the following EXCEPT A phosphorylation of serine…
A: Histones are highly basic proteins that compress DNA within the nucleus to produce chromatin, which…
Q: QUESTION 50 Expression of the maternal vs paternal alleles for the Igf2 gene is determined by: O…
A: 50. Expression of the maternal vs paternal allele for the Igf2 gene is determine byimprinting…
Q: QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses…
A: Base excision repair (BER) corrects lesions in the base that don't significantly distort the DNA…
Q: Question 26 transcription activator bound at the activator binding site O Gene is switched ON O Gene…
A: Ans - Transcription activator bound at the activator binding site to switch on the gene. # These…
Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…
A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…
Q: Question 39 A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance…
A: DNA is a genetic material, composed of deoxyribose sugar, phosphate group, and nitrogenous bases.…
Q: During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. a…
A: During the synthesis of DNA, at each replication fork, two strands of DNA are synthesized one is…
Q: QUESTION 39 Histone acetylation leads to which of the following events? Oa. DNA becomes more tightly…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Question 32 Base pairing between the codon and the anticodon is O antiparallel complementary both a…
A: Codon Codon is a trinucleotide DNA sequence code for amino acid.
Q: tRNA exits the ribosome at the _______________ site.
A: Transfer RNA is involved in protein synthesis as it brings specific amino acid to the correct…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: Question 14 Methylation silences the gene expression. O True O False
A: DNA stands for deoxyribonucleic acid and it is a molecule that has polynucleotide chains that are…
Q: QUESTION 19 The role of primase at the replication fork is to... O A. decatenate (unknot) DNA B. O…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: QUESTION 16 You are going to perform Next Generation sequencing on samples of RNA from cancer and…
A: The next generation sequencing is the advanced technology in field of determining the sequence of…
Q: Question 13 The absence of a sigma factor will never initiate transcription. A True B) False
A: Introduction:- The enzyme RNA polymerase copies a specific segment of DNA into RNA during…
Q: Question 16 The mechanism of activation of eukaryotic genes involves addition and removal of…
A: Gene is a stretch of RNA that encodes a functional product either in the form of RNA or a protein.…
Q: Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding…
A: Transcription is the process of synthesizing the mRNA from the template strand of DNA.
Q: QUESTION 4 After isomerization and resolution of a Holliday Junction, the resulting chromosomes are:…
A: The shuffling of genes (alleles) between chromosomes is referred to as recombination. This allows…
Q: Question 3 In the polymerase chain reaction A conditions must be carefully controlled to prevent…
A: PCR is a technique which amplifies a DNA template or strand to produce thousands number of copies of…
Q: Question 11 The triplet code allows many amino acids to be specified by more than one codon. Such a…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: QUESTION 9 The function of DNA polymerase in the process of DNA replication is , O a. to prevent the…
A: Answer: The function of DNA polymerase in the process of DNA replication is b. to catalyze the…
Q: QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive…
A: As per the guidelines we are supposed to answer only the first question in case of multiple…
Q: Question 14 Short regions of chromosome 1 were sequenced in a population of C. elegans. These…
A: INTRODUCTION The three common haplotypes are shown, along with their frequencies in the population.…
Q: Question 17 The genetic code in unambigous that means many codons can code for the same amino acids.…
A: Answer : The genetic code in unambiguous that means that codons can code for the same amino acids .…
Q: Question 22 What is a noncoding, repetitive DNA sequence at the end of chromosomes? a. telomere O b.…
A: Chromosomes These are defined as the thread-like structures which is located inside the nucleus of…
Q: Identify the best match between the mutation description and term.
A: As we know that there are 20 amino acids and the total codon are 64 of which 3 are stop codon. So we…
Q: These are enzymes that untwist the double helix at the replication forks of replicating DNA.…
A: Deoxyribonucleic acid(DNA) is defined as biological molecule where it consists of two polynucleotide…
Q: Question 20 The initiation factors form a complex with RNA polymerase O Gene is switched ON O Gene…
A: The initiation factor form a complex with RNA polymerase when gene is switched on . when the gene is…
Q: Question 41 The helical turns of the DNA does not only provide spaces for binding with regulatory…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two nucleotide bases that coil around one…
Q: QUESTION 20 Polyunsaturated fats a. are gas at room temperature b. are solid at room temperature c.…
A: 20. Definition: Fatty acids having more than one double bond are called polyunsaturated fatty acids…
Q: Question 3: Imagine that you isolated X-receptor MRNAS from mutant cells with the nonsense mutation…
A: Non-sense mutation Nonsense mutation also known as stop mutation is the mutation that causes a…
Q: Question 38 The 2 chains composing one double helix run in opposite directions; they are…
A: Yes its a true statement , the two strainds of the double stranded DNA runs in the antiparallel…
Q: QUESTION 5 In the Sanger method of DNA sequencing, if a dideoxynucleotide is attached, a…
A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…
Q: Question 2 DNA replication requires the participation of at least 8 nucleoside triphosphates. (A…
A: DNA replication is a process where two copies of daughter DNA are made from one parental DNA.…
Q: Question 44 DNA positively supercoils during replication and negatively supercoils in transcription.…
A: The degree of twist in a DNA strand affect the number of strain on it, that is referred to as DNA…
Q: QUESTION 7 Most polymorphisms do not result in a phenotypic difference because they are typically O…
A: Mutation is defined as the change in gene sequence. It is a random process.
Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…
A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…
Q: QUESTION 19 Place the following steps in the expression of the lac operon in the order in which each…
A: Lac operon is found in E coli and many other gastrointestinal bacteria It is important for the…
Q: These are enzymes that untwist the double helix at the replication forks of replicating DNA.…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: QUESTION 8 Intercalating agents such as acridine orange function as mutagens to O A. promote…
A: Mutagens are any chemical or physical agents that can harm DNA by altering its nucleotide sequence.…
Q: QUESTION 7 If a person avoided all mutagens, they would not have any mutations O True O False
A: Mutagen Mutagen is a physical or chemical agent that causes mutation i.e. changes the genetic…
Q: Question 25 Enhancer and activator proteins are working together O Gene is switched ON O Gene is…
A: Gene is a specific sequence of nucleotides in a DNA which encodes a particluar protein.
Q: Question 37 Overexpression of a proto-oncogene can cause cancer. Which of the following can cause…
A: Proto oncogene is a normal gene which becomes an oncogene after the mutation or alterations.There…
Q: Along with modification of histones and positioning of nucleosomes, following is one of the main…
A: Epigenetics deals with how the environment and lifestyle behavior can influence the functioning of…
Q: Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this…
A: RNA polymerase involved in mRNA synthesis or transcription process. Through transcription…
Q: Question 2 The width of the double helix is 3.4 nm. O True O False
A: Double helix is description given to DNA double strand, which have two strands twisted among each…
Step by step
Solved in 3 steps
- The activity of ________ will result in an increasedpositive charge on the histone. Question 24 options: Histone acetyltransferase Histone deacetylase Histone methyltransferase Maintenance methylase Histone demethylaseQUESTION 5 For each of the following epigenetic modifications, describle how it affects transcription using the answers below: a Increases trasnscription b. Decreases transcription c. Can increase or decrease transcription depending on which amino acid/nucleotide is being modified. Histone acetylation Histone methylation DNA methylation 富Question 2: Mutations - Create a nonsense point mutation in this coding region of the gene. Make sure to highlight the mutation you made using a different color or highlighter. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acid
- O Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak localQuestion 7 of 10 Question 7. What are the first three amino acids in the protein that is produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGATGGCTAGT... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCTACCGATCA.. 5' Start siteSimilar to prokaryotes, eukaryotes have a topoisomerase-ll-class enzyme called DNA gyrase, which can introduce negative supercoils into the relaxed circular DNA using energy of ATP. O True O False e Ques Moving to another question will save this response
- Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is added to the DNA sequence above.Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: LeucineHello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
- Question 4 a-D-galactose from B-D-glucose can be differentiated using which method of analysis? All of these Methylation analysis O Use of exoglycosidases NMR by the change in chemical shiftQuestion 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start siteArthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol. I'm DONE being this guy's messenger boy. IMI He can leave the nucleus and do it himself for all I carel IT Arthur, the mRNA, was at the end of his strand at work.