Q: Why are cell membranes disrupted by soap?
A: Please note that of the two unrelated questions posted together, the first one has been answered…
Q: Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are…
A: Nuclease is the nucleic acid digesting enzyme. Nuclease is of two types 1. exonuclease…
Q: QUESTION 18 Which of the following statements about termination mechanisms for nucleic acid…
A: Transcription termination is the process where a nascent RNA is released from its complex with RNA…
Q: QUESTION 6 In a molecule of DNA nitrogenous bases form hydrogen bonds, which hold the two DNA…
A: The DNA and both are nucleic acids that are made up of nucleotides. Nucleotides are made up of…
Q: QUESTION 1 Which of the following is NOT true of B form nucleic acid duplexes? O It is the form…
A: B-DNA is the Watson-Crick double helical structure. It is most stable and predominant structure…
Q: QUESTION 11 The aminoglycosides directly target which structure of the bacterial cel1? O cell wall O…
A: Antibiotics are substances that are commonly used to treat microbial (bacterial) infections.…
Q: Question 28 The anticodon of a tRNA is 5'UUG. What codon(s) can be theoretically recognized by this…
A: RNA is a type of nucleic acid which is comprised of single standard poly nucleotide chain and…
Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…
A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…
Q: Question 1 What gives the DNA molecule a negative charge? (A deoxyribose (B) ribose c phosphate…
A: DNA or deoxyribonucleic acid is genetic material in living organisms that are responsible for…
Q: 19. For this question, you will need to use the table for the genetic codes provided on the…
A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…
Q: Q. 693 kbps is equals to how many Bps?
A: bps means base pairs. bps also represent bits per second. Base pairs are present in DNA and RNA…
Q: QUESTION 6 The image below from the work of Meselson and Stahl tells us that: NOURS 21 43 2 B13 255…
A: Introduction : DNA or Deoxyribonucleic acid is the genetic material found in all living organisms.…
Q: Question 2 What can we most-accurately say about the polypeptide with the primary sequence KNEADING?…
A: The amino acids are classified on the basis of polarity of the side chain into nonpolar and polar.…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…
A: In this image the process of transcription is shown where an mRNA is being translated with the help…
Q: Question 3 Not yet answered Points out of 1.00 P Flag question Which of the following have…
A: Nucleic acids are the molecules that cells use to store, transfer and express genetic information.…
Q: Question 39 A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance…
A: The DNA or deoxyribonucleic acid is the double stranded molecule that is present in the nucleus of…
Q: QUESTION 2 Which of the following pairs of tRNA antiqodons is most likely to be used in translation…
A: Polypeptide synthesis relies on a constant supply of tRNAs that are charged with 20 amino acids.…
Q: Question 6 Compare and contrast DNA and RNA in terms of structure and function. Answers will vary…
A: Both DNA and DNA are the genetic material. DNA : deoxyribonucleic acid RNA: ribonucleic acid
Q: QUESTION 4 Which of the following DNAs is most likely to contain the recognition sequence for a…
A: DNA (Deoxyribonucleic acid) recognition sequence is a specific linear sequence that is recognized by…
Q: Which type of mutation results in no change in amino acid sequence for the protein? Silent…
A: A mutation is a sudden change that occurs in our DNA sequence either due to mistakes when DNA is…
Q: QUESTION 2 Which of the following statements about nucleic acid synthesizing enzymes (polymerases)…
A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…
Q: QUESTION 3 Is it possible to dissolve DNA in water? a. Only during cell division O b. No, DNA is…
A: Genomic DNA is the set of DNA which comprises of the genome of an organism. The genome is the…
Q: Question 7 of 10 Question 7. What are the first three amino acids in the protein that is produced…
A: More closely related species have more comparable "amino acid sequences" in the same protein,…
Q: Question 38 Which of the following process about conjugation is NOT true ? When a part of the…
A: Conjugation may be defined as the temporary union of two bacteria or unicellular organisms for the…
Q: QUESTION 24 What is the name of chemical agents that alter specific bases within DNA after completed…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Question 6 Which of the following is true of the base content of dsDNA? A moles of thymine = moles…
A: There are four nitrogenous bases of DNA which are Adenine, Guanine, thymine, and cytosine. Guanine…
Q: Question 4. Why is a single-stranded, circular DNA an ineffective template for DNA polymerase?
A: Introduction Single-stranded DNA is a DNA molecule that has only one nucleotide strand while…
Q: QUESTION 1 Match the discovery with the individual or groups that discovered it. (names may be used…
A: Introduction DNA:- It is a long molecule that contains our unique genetic code, It transmits the…
Q: QUESTION 2 Which of the following is NOT true of cutting DNA in biotechnology? O A. A molecular…
A: Cutting of DNA It is done by restriction enzymes. When these enzymes come in contact with a shape in…
Q: Question 2: Which of the following mutations may affect translation initiation? A. Silent mutation…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: QUESTION 1 Write the order of nucleotides in mRNA that would be transcribed from the following…
A: Transcription is the process by which mRNA is synthesized from a DNA template. During transcription,…
Q: Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA…
A: Primer is a small sized single stranded monomeric nucleotide needed by all living creatures to start…
Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: What is the most stable nitrogenous base pairing?
A: Base can be purines (adenine and guanine) two ring structure and pyrimidines (cytosine and thymine).…
Q: QUESTION 3 Is it possible to dissolve DNA in water? a. Only during cell division b. No, DNA is…
A: A solution is a combination of two compounds or more. The solute is the soluble material, and the…
Q: Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' Label…
A: DNA is a genetic molecule which undergoes replication and is required for protein synthesis.
Q: QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an…
A: Gel electrophoresis is general lab techniques to determine the quality and quantity of DNA/RNA in…
Q: What is the purpose of the inverted repeats at the ends of DNA-based transposons? A. The inverted…
A: Transposons, also known as jumping Genes, are DNA sequence that move from one location of a genome…
Q: Question 1 of 10 Question 1. You isolate a mouse Tau-gene-containing DNA fragment from the chicken…
A: Heterogeneous nuclear RNA (hnRNA) is a pre mRNA formed after the transcription of DNA. This is…
Q: Question 4 Match the following steps of protein synthesis. > > The amino acids are joined together…
A: Introduction Protein synthesis:- Protein synthesis is the process in which cells make proteins,…
Q: QUESTION 40 If we had 6 different DNA/RNA nucleotide bases, strings of how many nucleotides would be…
A: Amino acids are the monomers for the formation of peptides or proteins having a chiral carbon with…
Q: These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA…
A: DNA is the type of genetic material present in the organisms like humans and plants. The structure…
Q: Question 28 Multiple Answer Question: Which of the following statements about the Watson-Crick model…
A: Deoxyribonucleic acids or DNA is a type of nucleic acid present in the nucleus of the cell. It is…
Q: Which of the following is the start codon? GUC CCC UAG AUG
A: Start codon It is the first codon of the mRNA transcript that the ribosome translates. This codon is…
Q: Using complementary base pairing method, convert the following DNA sequence into RNA sequence. DNA:…
A: DNA is composed of two strands which are twisted in nature that surround each other to generate a…
Q: Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing…
A: DNA sequencing is a method that gives the order of nucleotide bases. Methods used for DNA sequencing…
Q: Question 1: The diagram below depicts an eukaryotic gene. In which region would the insertion of a…
A: A particular gene is transcribed into RNA by the process known as transcription and that RNA is…
Q: Question 7 Which of the following best describes the structure of a nucleosome? approximately 15 bp…
A: The DNA within the eukaryotic cells are present in highly condensed form with specific protein…
Question:-
1. ATT GAC CAA ATC CAT TGA GAC CAA
What chains occur when modified DDTP thymine is added to the DNA sequence above.
Step by step
Solved in 2 steps
- Question 1 I . Protein Synthesis – complete the chart for this coding region of a gene. DNA sense ATG AAA CGA GTT ACC GAA ACT TAA DNA nonsense mRNA codon tRNA anticodon Amino acid-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'
- Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGCQuestion 31 What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 O 3- AUUGCGGAUGCCCGUAUACG -5 O 5- AUUGCGGAUGCCCGUAUACG -3 O 5 - AUUGCGGAUGCCCGUAUACG -3 O 3- UAACGCCUACGGGCAUAUGC -5Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterMutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________AU Py U AGGC C UGGC G GG C Jc What modified nucleoside base is indicated by the arrow? dihydrouracil pseudouracil -ACC.
- Question 6 Which of the followng causes mutabons that are considered induced? O sunight Otutomrercation of purine and pyrmidine bases O DNA polymerasa11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________