Question 24 Listen A unicorn has 11 pairs of chromosomes. How many sister chromatids will it have at metaphase of mitosis a) 11 b) 44 ○ c) 2 d) 22

Q: Question Select your answer. What is chromatin composed of? DNA + Protein DNA + Carbohydrate RNA +…

A: In nucleus, DNA is not present in a completely free linear form. This is because nucleus cannot…

Q: Question 7 What experiment could you perform to test if KDEL is necessary for protein retention in…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question: Some states are setting up archives of DNA profiles for all convicted criminals. Should…

A: A investigative method used to identify people based on their DNA is called DNA profiling, also…

Q: "Consider the arrangement of the following four normal chromosomes from some hypothetical organ…

A: Mutation is defined as any change in the DNA sequence of any organism. It can result due to error in…

Q: This next question is good practice to be familiar with thinking about what happens to chromosomes…

A: The replication is the process by which new DNA is synthesized from the old DNA molecule by…

Q: Genetic question

A: Formulas for three point test cross - A. Distance between two genes = (#progenies obtained by SCO…

Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…

A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: QUESTION 21 You sequence the XRAY gene with Sanger sequencing. A portion of the sequencing gel is…

A: The Sanger sequencing is used to determine the sequence of fragment of DNA. The gel electrophoresis…

Q: Among the following, which one is trans-acting transcription element?       Enhancer   Silencer…

A: Trans acting transcription element : These are also known as transcription factors , which either…

Q: 17 Which of the following is the reason that 5' exons are usually spliced to exons that are nearby…

A: Exons: An exon is a segment of DNA that codes for a specific sequence of amino acids in a protein.…

Q: Question 14 A ten-fold increase in the concentration of sodium ions increases the Tm temperature of…

A: DNA (deoxyribonucleic acid) is the genetic material in most of the cells. It is a double stranded…

Q: trivia about down syndrome. Give me 10. how the down syndrome occurs?

A: A genetic disorder is a hereditary condition that occurs due to abnormalities in the genome. Genetic…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments…

A: Agarose gel electrophoresis is one the technique used in Recombinant DNA Technology and Molecular…

Q: Scenario 2: Examine the following DNA strand. The coding strand is on top and the template strand…

A: DNA is a template for making proteins that are essential for cellular functions. The process of…

Q: Genetics Question 9

A: The objective of the question is to determine whether a mutation in an enhancer that prevents the…

Q: Question 2 "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…

A: Muttation is a phenomenon that occurs due to the alternation in the nitrogenous base pairs in the…

Q: Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O…

A: Introduction:- DNA ( Deoxy-ribonucleic acid) is a polymer of deoxy-ribonucleotide units, they are of…

Q: Can substitute bases in DNA because of structural similarity.

A: A mutagen is a physical or chemical agent that permanently alters genetic material, usually DNA, in…

Q: Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a person…

A: Sickle cell anemia is a genetic disorder. It is condition when the normal red blood cells change its…

Q: Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense…

A: Nonsense mutation is a mutation which occur when a working codon is transformed into one of the…

Q: Question 23 Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a…

A: A series of genetic diseases collectively referred to as sickle cell disease includes sickle cell…

Q: tely the same amount of DNA? und: You have learned that DNA is n chromosomes. All mammals are…

A: Haploid number means that one set of chromosomes is present where the chromosomes are unpaired.…

Q: True OR False. During interphase, the chromosomes are tightly bound and visible under a light…

A: Interphase is the major part of the cell cycle  and incorporates the stages as G1, S and G2 stages.…

Q: 22

A: The objective of the question is to match the given molecules with their respective definitions or…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity.  Complementarity is…

Q: In the next experiment, MCF-7 cells were treated or not with indibulin and the effect of this drug…

A: Question: Comment Figure 4 globally (make the parallel between the left images and the graph on…

Q: Consider mitochondrial inheritance in the family shown below. (No one is shaded-in because we are…

A: As mitochondria contain their own DNA, which is a tiny circular extranuclear DNA, they are also…

Q: Question 5 The initiation of protein synthesis or regulation of gene expression can be controlled by…

A: Gene regulation refers to the mechanisms that act to induce or repress the expression of a gene.…

Q: 50. Which of the following represents the inactive X-chromatin in female cells? O euchromatin O…

A: Given: The following represents the inactive X-chromatin in female cells.

Q: Question 3 In DNA, the terms 3' and 5' refer to the O A) bonds that form between adenine and thymine…

A: In the field of molecular biology, understanding the structure and replication of DNA is crucial to…

Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…

A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…

Q: QUESTION 40 If we had 6 different DNA/RNA nucleotide bases, strings of how many nucleotides would be…

A: Amino acids are the monomers for the formation of peptides or proteins having a chiral carbon with…

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie…

A: PNA peptide nucleic acid is the artificial Nucleic acid structurally similar to nucleic acid.

Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…

A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…