Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA HO. that could increase solubility without drastically reducing duplex stability. PNA R1 HN Base Base Base Base =P-O° NH Base Base Но NH R2

Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA HO. that could increase solubility without drastically reducing duplex stability. PNA R1 HN Base Base Base Base =P-O° NH Base Base Но NH R2

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides have similar interactions?
Since mammalian DNA contains roughly 25% thymine residues, why do mammalian cells need a thymine-DNA glycosylase?
Question 10. Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments migrate faster than larger fragments because they can move faster through the agarose pores. B) Large fragments migrate faster than small fragments because they carry more negative charges. C) DNA fragments migrate towards the positive pole. D) Supercoiled DNA may migrate significantly different through the gel than linear DNA of equal size. E) The higher the agarose concentration the better the separation of smaller fragments as compared to larger fragments.
Question: A decapeptide composed of ser, ala, IIe. his, trp, phe was treated with 1-flouro- 2,4-dinitrobenzene. It gave a DNP-his on the N terminal and free trp when treated with carboxypeptidase. Upon partial hydrolysis of the peptide, the following fragments were obtained. a. his-lle-phe-ala c. his-ala-phe e. ser-lle-his b. ala-phe-trp d. phe-ala-ser Give the amino acid sequence of the above decapeptide.
Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions. Multiple Choice
Answer each of the following with a word, phrase, or numeral (4 points each = 16 points). Please label your answers as (a), (b), (c) and (d). (a) Among (i) hydrophobic effect, (ii) van der Waals interactions, (iii) hydrogen bonds and (iv) conformational entropy, the force disfavoring duplex B-DNA formation from single strands. (b) Reason why salt bridges at the surfaces of cytosolic proteins are weak. (c) Type of nucleic acid duplex that forms when all glycosidic bonds are anti, chains are antiparallel, and all sugar puckers are C3' endo. (d) Amino acid that is most commonly found in the cis configuration in proteins.
Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
(a) You have found a new, enhanced version of the drug jafrasitor, (called jafrasitorplus) (molecular weight 600 grams/mol), that binds the histone deacetylase enzyme Sir2 with a dissociation constant KD = 0.03 nM. What mass of jafrasitorplus should be administered to a patient with a blood volume of 5.5 L such that Sir2 is at least 91% inhibited? Show your work and reasoning.
Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylase
Question 2. Ribosomes are cellular structures that are composed of protein and RNA; this structure is responsible for catalyzing peptide bond formation between amino acids during a process known as translation. a) Many antibiotics that kill bacteria target translation. Why might this be an effective mechanism to kill bacteria? Why don't antibiotics also kill human (eukaryotic) ribosomes? b) The antibiotic Kasugamycin (KSG) destabilizes the P-site of the ribosome. Describe what parts of translation would be altered in the presence of this antibiotic. c) How does the following graph show the efficacy of translational knockdown with KSG? Met-Methionine C % of Met incorporation 100 80 60 40 20 0 + 0 2 4 6 8 KSG concentration (mg/ml) 10
37Transposons in eukaryotes are mechanistically different from bacterial transposons. Yesorno 38The tRNA has a ( ) secondary structure. 39A single ( ) can be processed to produce two molecules or more different mRNAs.
Question 9B Why are host cell antiviral responses that target double-stranded RNA effective against single- stranded RNA viruses like influenza or coronaviruses? Would a system that responds to the presence of double-stranded RNA be effective against retroviruses? Explain.