QUESTION 17 The is defined as the difference in electrical charge between the inside and the outside of a patch of axon that an action potential is not currently moving through. O resting charge O local potential O local charge O resting potential
Q: 4. Consider the different types of SNPs shown in Figure 3: associated, unassociated, and causative…
A: As per our Q&A guidelines, we are supposed to answer only three subparts. Please repost the…
Q: Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’…
A: Transcription is the first stage of gene expression, in which a particular segment of DNA is copied…
Q: Q1.11. What is an ecological community? A group of individuals from a given species that interact A…
A: A subfield of research called ecology includes the fields of human science, demographic, population,…
Q: Your lab partner set up plate 4 by spreading a pure culture of E. coli onto the plate and addind…
A: Escherichia coli, more commonly known as E. coli, is a type of bacteria that is commonly found in…
Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…
A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: Vertebrate phylogenetic tree St. bony fish amphibians mammals turtles lizards snakes crocodiles…
A: sister taxa are pairs of terminal taxa branch from a common node and are often closely related…
Q: 3. Type of Transport: Reasoning: Balanced Concentration (Equilibrium) Describe the cell membrane as…
A: Type of transport : Osmosis Reason: Osmosis is a type of transport system for subsatnces through…
Q: Question: The vast majority of calico and tortoiseshell cats are female, however occasionally a male…
A: Yes, the majority of tortoiseshell cats are female. This is because the gene that determines the…
Q: This figure represents the ABC operon, which is a negative inducible operon, and its associated…
A: ANSWER: Functional structural proteins formed in the presence of molecule A are: test 1, test 2 and…
Q: The antibiotic, tetracycline was serially diluted (2-fold dilutions), starting with tube #1 (100…
A: Serial dilution is a mathematical way of lowering the concentration of any solution in a gradual…
Q: # 1. Match the following with the correct type of ecology: Use checkmark Population Community…
A: Ecology is the branch of biology that deals with the study of interactions between organisms and…
Q: Many people of Asian ancestry have alcohol dehydrogenase enzymes that are far more efficient than…
A: We know that Alcohol (Ethanol) gets converted into acetaldehyde with the help of enzyme alcohol…
Q: Determine the experimental design that makes the difference between the given two modes of action at…
A: The antisense ribonucleic acid is a type of single-stranded ribonucleic acid molecule that binds to…
Q: Why is heating important in endosperm staining procedure?
A: Staining is a technique used to make certain structures in a sample more visible under a microscope.…
Q: What does the medial corticospinal tract control? A. Bilateral movements of the trunk of the body B.…
A: The anterior corticospinal tract sends fibers mainly to the trunk or axial muscles.
Q: Increase of ATP concentration Dephcsphorylation of glycogen phosphorylase Increase of glucose-6-…
A: Glycogen synthesis Glycogen synthesis , also called glycogenesis is the process by which the liver…
Q: Pick either the pincushion cactus or the barrel cactus. Conduct an analysis and determine whether…
A: One of the most common cactus kinds for use as succulents is the barrel cactus. It is also one of…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…
A: In plants, Photosynthesis is the process of making food (glucose) and releasing oxygen by utilising…
Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…
A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…
Q: How does intron splicing work? Draw the mechanism. Label the branchpoint and lariat structures.
A: Introns are the non-coding regions of a DNA or an RNA sequence, whereas, the exons are the coding…
Q: 2) The intermediate disturbance hypothesis proposes that __________. A. the highest diversity in…
A: Introduction: The number of various species present in an environment and the relative abundance of…
Q: Aspirin inhibits cyclooxygenase enzyme. This enzyme makes the prostaglandin hormone type your…
A: INTRODUCTION Thromboxane This is a hormone that plays an important role in platelet aggregation,…
Q: Descibe the the date is the graph, what does it show and mean.
A: The given describes the number of days of antibiotics administered to 149 pet store puppies assessed…
Q: What is the new DNA sequence and the corresponding new amino acid sequence of these two mutations?…
A: Mutation is any change in the DNA sequence. These are of different types for example, missense…
Q: Which ingredient(s) cause MSA plates to be selective?
A: MSA (mannitol salt agar) is a kind of selective media that is used for growing, isolation, and…
Q: e. On the stretch of mutant viral RNA below, draw translation in progress. Draw the following: ●…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…
Q: How does staining procedure relates to the benefit endospores provide to cells?
A: Endospore Staining-The main purpose of endospore staining is to differentiate bacterial spores from…
Q: 5. In the absence of mutation, the heritability of neck length in a population of giraffes would…
A: Evolution refers to the change of characteristics of a population that can be inherited from one…
Q: Why do many tumors metastasize (e.g. what advantage does it give them) and why can metastatic…
A: Metastasis is a complex process that is not fully understood. However, it is clear that the ability…
Q: The Epithelial-Mesenchymal Transition (EMT) is mediated by which of the following (select all that…
A: EMT or epithelial-mesenchymal transition is a series of events that allows a polarized epithelial…
Q: In January 2010, a population of organisms had a size of 564. By the end of the year 109 of those…
A: In january 2010 , population of organisms had a size of 564 By the end of the year 109 had died so…
Q: What is it called when some nutrients can not be adequately measured to create an RDA or EAR value?
A: Dietary reference intake consists of 4 reference values based on nutrition according to their…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: Q4.14. Recall that in the big Yellowstone fires, lodgepole pine burned and then grew back within…
A: Introduction: Lodgepole pine (Pinus contorta var. latifolia) forests is the highly resilient to…
Q: EVOLUTION LINK Explain some of the evolutionary implications that one can conclude from mice and…
A: Introduction Heritable traits—the hereditary features of an organism—change over the course of…
Q: Compare and contrast the different experiments of Redi,Needham,Spallanzani and Pasteur on the origin…
A: Origin of life has many theories with various interpretation. Each and every theory differs from one…
Q: A student wishes to carry out an investigation to determine the role of the drug CORA against MCF-7…
A: Cancer is a broad term used to describe various diseases in which abnormal cells divide and grow…
Q: Use the shapes tool to outline the following: ETC in Blue NADH Pre-work 1 Proton gradient in Red…
A: The "electron transport chain is a series of redox processes that transmit electrons from a source…
Q: Major event of special creation theory
A: The research of how life on Earth emerged from non-living materials is known as abiotic biology,…
Q: ob woH svo od bolles et fill de 2. From the information given in the chapter about the ABO blood…
A: Codominant alleles establish the blood type of an individual. The IA, IB, and I genotypes are three…
Q: How to calculate Km value and Vmax in buffer 1 and 2
A: The enzyme kinetics can be represented by the Line Weaver Burk Plot. This is a plot made by plotting…
Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…
A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…
Q: 2. A quantitative genetics determined the following variance components in a population of crabs…
A: Introduction: As per the given information: "The total variance or phenotypic variance (VP) is the…
Q: Which of the following best supports the endosymbiotic theory of the evolutionary origin of…
A: Except for chloroplasts, mitochondria don't seem to have a common ancestor with any other organelle.…
Q: please give an evolution timeline about dogs. (7 keypoints please) Please use the format below
A: The domestic dog, also called as Canis familiaris or Canis lupus familiaris, has earned the title of…
Q: What is the concentration of a DNA solution with an OD260 measurement of 3.175 if 1OD unit at 260nm…
A: Introduction : A material's optical density describes its slow tendency for holding onto the…
Q: what scale of study would you study as an Community ecology
A: Introduction Ecology is a branch of science which deals with the study of the relationship between…
Q: Compare the sample variances of P1 and P2. Account for any differences. Similarly, compare the…
A: P1 and P2 have the difference of 0.95 in their variance. This denotes that there would be variations…
Q: Based on the knowledge acquired about the conservation and propagation of microorganisms, propose…
A: Yeast is a eukaryotic organism that belongs to the fungus kingdom. It is single-celled and is used…
answer for 14, 17
Step by step
Solved in 2 steps
- Required information Multiple Choice Local currents Action potential Acetylcholine is released into the synaptic cleft under the influence of Sodium ions 0:00 0:45 Low concentration of choline Calcium ions -Presynaptic terminal 1x Omatch the letters to the correct terms using the figure synaptic vesicle neurotransmitter pre-synaptic neuron post-synaptic neuron neurotransmitter receptorrespondus password is 515b73158335f6 Question 12 An inhibitory postsynaptic potential (IPSP. is associated with O hyperpolarization O opening of voltage-regulated channels O a change in sodium ion permeability O lowering the threshold for an action potential to occur < Previous
- A A Aa v Ao O... 11 AaBbCcDdEe AaBbCcDc AaBbCcDdE AaBb( AaBbCcDdEE AaBbCcDdEe U v ab A ev A v X, Normal No Spacing Heading 1 Heading 2 Title Subtitle temporal summation spatial summation Unidirectional and non-degrading Action potential o Depolarization; Na gates opening o Repolarization: K gates opening o Hyperpolarization: K gates closing Movement down an axon Refractory periods Myelin and Axon size effect Action potential stimulated release Neurotransmitter (NT) recycling Neurotransmitters o Acetylcholine Biological amines (Serotonin, norepinephrine and epinephrine) Single amino acids (Glutamate and GABA) Fast and Slow effects and Receptor effects The Autonomic System Division definitionA few more Action Potential Questions, please help.My question is how can spatial summation of synaptic potentials make it easier for a neuron to reach action potential threshold?
- My question is how can temporal summation of synaptic potentials make it easier for a neuron to reach action potential threshold?Match the stages of action potential with the appropriate image or description. PICK AND MATCH FROM THESE 1. Resting membrane potential 2. Threshold 3. Depolarization 4. Repolarization 5. Hyperpolarization 6. Refractory period The potential difference that must be met in order for an action potential to be generated When the potential drops below resting level Location 3 on this image When the potential starts to decrease again after it has reached a maximum Location 4 on this image Occurs at -77 mV When the membrane is resetting and an action potential cannot yet be produced again When the sodium channels are open Occurs at -55 mVwill auto-submit when time expires espondus password is 515b73158335f6 Question 17 The part of the neuron that normally receives stimuli is called O a Schwann cell O a neurolemma a dendrite Oan axon < Previous
- Home Page - Comp C Discussion 9-HUML Quiz - Attempt 2 Oher bookmar Lab Manual Exercise 14 Post-lab Quiz Question 1 3a 14 > Part A Which of the following statements is correct? O Myelin sheaths form an insulating layer around the axons of neurons in the central and peripheral nervous systems. These structures function to speed up the transmission of impulses along the axon O Myelin sheaths form an insulating layer around the cell bodies of neurons in the central and peripheral nervous systems. These structures function to speed up the transmission of impulses along the axon O Myelin sheaths form an insulating layer around the axons of neurons in the central and peripheral nervous systems. These structures function to slow the transmission of impulses along the axron Myelin sheaths form an insulating layer around the axons of neurons only in the peripheral nervous system. These structures function to speed up the transmission of impulses along the axon Submit Request Answer Next> pvide…Subject: Neurophysiology Describe pre- to –post synaptic signaling in the CNS. Underline (or circle if you make a drawing) places where there are major differences between the CNS and the neuromuscular junction.Subject: Neurophysiology During an action potential the Na+ current is inward and K+ current is outward. You may have been surprised to learn that the intracellular concentration of those ions does not change even after many action potentials. Why not?