Question 17 Listen Which of the following can result from alternate splicing of a gene that has 6 exons An intron will be left in the final mRNA The final mRNA will have 2 exon 3s All of the above will result from alternate splicing The final mRNA will lack exon 4

Question 17 Listen Which of the following can result from alternate splicing of a gene that has 6 exons An intron will be left in the final mRNA The final mRNA will have 2 exon 3s All of the above will result from alternate splicing The final mRNA will lack exon 4

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: I am a second-year computer science major. I decided to take this course because I am currently in…

A: Let's break down how the provided answer comprehensively addresses the question: Acknowledgment of…

Q: Match the following solutions to examples that address problems for biodiversity.…

A: Haida Gwaii Watchmen - listen to local people's perspectives.The Haida Gwaii Watchmen program is an…

Q: Is rapid antibody testing a form of ELISA? Explain your answer. How is an ELISA different from rapid…

A: The objective of the question is to understand if rapid antibody testing is a form of ELISA…

Q: detail how cation exchange chromatography works and what you would use to elute your target protein.…

A: Cation exchange chromatography is a technique used to separate proteins based on their net surface…

Q: Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).

A: These nucleotides are connected by phosphodiester bonds between the 3' carbon of one sugar molecule…

Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…

A: The objective of this question is to calculate the total number of cells in the culture medium using…

Q: What programs and resources would you use to help establish the changes to stop the opioid epidemic?

A: Here's a more detailed explanation of the programs and resources that can help establish changes to…

Q: Calculate the number of bacteria (CFU/ml) in each serum and saline sample. What was the purpose of…

A: Calculating CFU/ml in Serum and Saline SamplesTo calculate the number of colony-forming units per…

Q: Gel Electrophoresis A. Why does DNA travel toward the positive electrode in the gel chamber? B. What…

A: Approach to finding a solution to the problem:1. Have a solid understanding of the fundamentals of…

Q: GQ6

A: Approach to solving the question:Comprehending the variances in hair, skin, and eye color is…

Q: What is an example of how migration causes changes in gene frequencies?…

A: The objective of the question is to understand how migration can cause changes in gene frequencies.…

Q: Abu Abd-Allah ibn Musa al-Kwarizmi, born in the Islamic capital city of Baghdad, and familiar with…

A: The question is asking about the discipline that Abu Abd-Allah ibn Musa al-Kwarizmi, a scholar born…

Q: Despite their excellent hygienic practices, the Kelatavicla lab experiences a devastating bacterial…

A: The objective of the question is to predict the change in frequency of the R allele in the mouse…

Q: What kind of disorder is Jacobsen syndrome? What are symptoms?

A: Jacobsen syndrome, also known as 11q deletion disorder, is a rare genetic disorder. This disorder…

Q: Question 4 1 pts What terms best describes the ability of muscle to recover from contraction? ○…

A: The objective of the question is to identify the term that best describes the ability of a muscle to…

Q: Question 1 0.5 pts Which of the following is not one of the 4 main fields of Anthropology? Cultural…

A: 1. Answer:- Modern AnthropologyExplanation:Anthropology is broadly divided into four main…

Q: . Calculate the 2 possible values of x in this equation: x2 – 16x + 48 = 0, either by using the…

A: The objective of this question is to find the two possible values of x in the given quadratic…

Q: If 80% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 60…

A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…

Q: Which of the following is not an explanation for the lack of Hepatitis C eradication? A) High rate…

A: The fact that hepatitis C strains do not exhibit broad resistance to antiviral drugs is not often…

Q: with the uses of 3 articles explain the distrubation of infectiousn pathogens

A: The objective of this question is to understand the distribution of infectious pathogens, using…

Q: 3:09 1 Back Pulse Question 31 (Mandatory) Which condition causes breathing rate to increase? a)…

A: QUESTION 31Here's how I arrived at the answer (c) increased blood [carbon dioxide]: The respiratory…

Q: BIOL2201, S24 Dissection 3- Sheep Heart Good source: https://www.youtube.com/watch?v=-ZbXiOrlFJI…

A: Approach to solving the question:Preparation: Gather all necessary materials for the dissection,…

Q: Consider a population of cells where some cells are cooperative and some cells defect (are selfish).…

A: The image shows a payoff matrix for a cell population, indicating cooperative (C) and defective (D)…

Q: Strato of Lampsacus, a student of Theophrastus in Aristotle’s Lyceum, made which of the following…

A: The question is asking about the contradiction made by Strato of Lampsacus, a student of…

Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…

A: The objective of the question is to determine the sensitivity and specificity of a urine test for…

Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…

A: Positive Inducible Regulation:- In positive inducible regulation, the binding of the regulatory…

Q: Label the following diagram with the correct words from the following list. Cell wall Nucleus…

A: Animal cells lack the cell wall, chloroplasts for photosynthesis, and a large central vacuole found…

Q: 6. A woman of blood group AB marries a man of blood group A, whose father was group O. What is the…

A: As per bartleby Q&A guidelines, we can answer only one question. Hence, repost the remaining…

Q: Leukemic lymphoma is when Question 3 options: A) Lymphoma cells have…

A: Leukemic lymphoma refers to a condition where lymphoma, a type of cancer that originates in the…

Q: According to Aristotle’s density equation, if 4.686 grams of the sugar glucose (C6H12O6) occupies a…

A: The objective of the question is to calculate the density of glucose using Aristotle’s density…

Q: What is the consequence of an error that is not corrected during DNA replication? Choose one: It…

A: The question is asking about the consequences of an uncorrected error during the process of DNA…

Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…

A: The objective of the question is to identify which type of mutation cannot be passed on to a…

Q: is no mystery how harmful a lot of environmental factors can be on a fetus nor is it misunderstood…

A: There are different kinds of birth defects which can be induced in the fetus either by some genetic…

Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…

A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…

Q: . Obtain information such as literature, macromolecules, organism-related PDBentries, FASTA sequence…

A: The objective of the question is to obtain and explain the information related to the Human serum…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: There is a new virus named Zmatanelia that is infecting monkeys in the UK. This is a novel virus and…

A: Sample Collection: Obtain tissue or bodily fluid samples from infected monkeys in the UK. Ensure…

Q: Forces are always acting on the genes of a population, causing natural selection to occur. Describe…

A: The objective of the question is to understand the forces that affect the genes in a population,…

Q: Whisker number in a new breed of mouse is controlled by 2 genes. The line with no contributing…

A: When crossing an AaBb mouse with an AaBB mouse, the offspring can have four different genotypes:…

Q: Briefly describe the overall message of figure 1C

A: Figure 1C presents a detailed depiction of the gene network associated with the gastrointestinal…

Q: Determine the order of the steps in photosynthesis and how they are interconnected in the Calvin…

A: The steps in photosynthesis are interconnected in the Calvin cycle as follows:1. Carbon Fixation: In…

Q: Tale Which of the following are determinants of arterial oxygenation? Select all that apply. A) CO2…

A: A) CO2 levels in the blood: The amount of carbon dioxide (CO2) in the blood can affect arterial…

Q: plx explain in deatiled the distrbution of pathogen

A: The objective of this question is to understand the distribution of pathogens, which are…

Q: none of the above Question 13 Which combination of organelles has never been found in an animal…

A: The combination of organelles that are not found in an animal cell is *option-2: Mitrochondria ,…

Q: D Question 2 Name the specific tissue type that would serve as the "binding material" between a…

A: The objective of the question is to identify the type of tissue that acts as a 'binding material'…

Q: Which of the following is true of ribozymes? Ribozymes sound like "enzymes" but do not have…

A: Ribozymes are RNA molecules or RNA–protein complexes that are catalytically active, with the…

Q: The diagnostic cell in Hodgkin's disease is the: Question 5 options: A)…

A: The objective of the question is to identify the specific cell type that is characteristic of…

Q: 3 Compound A is an optically active mixed triglyceride, for which the following apply: a) contains…

A: ### Triglycerides and Fatty AcidsTriglycerides are esters derived from glycerol and three fatty acid…

Q: According to Jean Buridan’s equation, the momentum or “impetus” of an 88 kilogram mass moving at 5…

A: The objective of this question is to calculate the momentum or 'impetus' of an object with a given…

Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH…

A: Please give me helpful rating if you are satisfied with the graph.

Question

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Similar questions

QUESTION 10 The steady state level of a MRNA for a gene is affected by the following mechanism(s) O Rate of RNA synthesis O The levels of nonsense suppressing TRNAS Rates of RNA synthesis and degradation Rate of RNA degradation O Frequency of AUG codons
Question 23 0/1 point If the nonsense mutation is in the last exon of the MRNA, the result would be: O nonsense-mediated decay truncated MRNA a splice variant no expression
Question 18 Release factors involved in translation supply a source of energy for termination of translation. bind to the stop codon in the A site of the ribosome, in place of a tRNA. release the ribosome from the ER to allow polypeptides into the cytosol. release the amino acid from its tRNA to allow the amino acid to form a peptide bond.
QUESTION 21 Consider the following template strand of DNA: AAT TCA CCC 3' 5' The mRNA made from this strand would be: UUA AGU GGG (from 5' to 3') The amino acid sequence from this strand would be: (from N to C. Use the 3 letter code with dashes between each) On your handwritten portion draw the chemical structure of this peptide
QUESTION 13 O a. Chromosomes O b. Multivariate expression O c. Monocistronic mRNA O d. Homeostasis O e. Alternative splicing refers to the phenomenon whereby a single type of pre-mRNA may give rise to multiple types of mature mRNAs due to different patterns of intron removal during RNA processing.
QUESTION 11 micro-RNAS (MİRNAS) regulate gene transcription MRNA translation and stability splicing of MRNA precursors MRNA 3' cleavage MRNA transport into the cytoplasm
QUESTION 12 Small nuclear RNAS (SNRNAS) regulate gene transcription O MRNA transport into the cytoplasm MRNA 3' cleavage MRNA translation and stability O splicing of mRNA precursors
Question 26 transcription activator bound at the activator binding site O Gene is switched ON O Gene is switched OFF O Does NOT affect the gene expression
Question 6 There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O nonsense mutation O silent mutation O frameshift mutation
Question 39 The heptapeptide repeat in the carboxy terminal domain (CTD) in the RPB1 subunit of RNA polymerase Il is phosphorylated to A convert to an elongation complex B activate termination bind to DNA D initiate transcription
Question 41 Elongation factor Tu (EF-Tu): (A) binds initiator tRNA and GTP. binds aminoacyl-tRNA in the presence of GTP. B (C) displaces GDP from the elongation complex. D binds GTP promoting translocation of ribosomes along mRNA.
QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in the disease allows the increase of a CGG repeat in a particular gene from a normal of about 30 repeats to 200-1000 repeats. This repeat is normally found in the 5' untranslated region of a gene for the protein FMR1. FMR1 might be involved in the translation of brain-specific mRNAs during brain development. The consequence of the very large number of CGG repeats in the DNA is extensive methylation of the entire promoter region of the FMR1 gene. Methylation of bases in DNA usually A. facilitates the binding of transcription factors to the DNA. B. makes a difference in activity only if it occurs in an enhancer region. C. prevents chromatin from unwinding. D. inactivates DNA for transcription. E. results in increased production of the produce of whatever gene is methylated.QUESTION NO. 2 The best definition of an endonuclease is that it hydrolyzes A. nucleotide from…