Q4. Using the method from this lab, what would be the genetic distance between Dog 1 and Dog 2 based on the following DNA sequences taken from the same place in each dog's DNA? Dog 1: GGGGCCCC Dog 2: GGGAACCC
Q: Questions a to e are answerable by yes or no. Indicate the possible parental genotypes if your…
A: A genotype is an individual's collection of genes. The term can refer to the two alleles for each…
Q: Glycolysis Pyruvate Oxidation Citric Acid Cycle Oxidative phosphorylation Total Molecules produced…
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. In…
Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…
A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…
Q: In an essay form describe how. Nitrogen in ground nuts can be found in the urea
A: A mechanism, whether natural or artificial, that enables free nitrogen (N2), a generally innocuous…
Q: Based on the schematic below, illustrating the control of the hypothalamus and the pituitary gland…
A: Menstural cycle is a monthly physiological process occurs in every female after puberty. It have…
Q: 18. In tomatoes, tall (D) is dominant over dwarf (d), and smooth fruit (P) is dominant over…
A: A dihybrid cross is a cross in which two traits are involved . Traits are characteristic features…
Q: In fruit flies, long wings (M) is dominant to miniature wings (m) and red eyes (B) is dominant to…
A: Introduction:- Genes are known as the units of inheritance. They are present on the chromosomes, in…
Q: What distinguishes proteins that will be released into the cytoplasm after translation from proteins…
A: Protein synthesised in cytoplasm enters the endoplasmic reticulum via pores and is modified there.…
Q: What is the description of the growth and growth pattern of the microorganisms in the pour plate…
A: Microbial cultures can grow in both solid and liquid mediums. A solidifying agent, such as agar, is…
Q: The figure below illustrates a generic model of neurotransmitter secretion and reception across a…
A: Neuron is the basic structural and functional units of the nervous system.They are able to respond…
Q: description of the growth and growth pattern of the microorganisms in the pour plate method?
A: What do you understand by the term pour plate method? Give a brief description of this method.. What…
Q: What is the lac operon?
A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…
Q: Flippases are enzymes which flip proteins from one face of the phospholipid bilayer to the other…
A: Phospholipid bilayer A hydrophilic exterior and a hydrophobic interior make up the two phospholipid…
Q: Briefly explain why having a forelimb lever with high MA is potentially advantageous.
A: Introduction : One of the paired articulated appendages (limbs) attached to the cranial (anterior)…
Q: Drag the images/descriptions given to the correct category to assess your understanding of the…
A: Introduction : Bacteria can be categorised in a number of ways depending on their morphology,…
Q: Which land plant innovations served to protect land plant offspring? Please select all correct…
A: there are several factory which help to survive a plant offspring but some certain factor applicable…
Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…
A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…
Q: 8. DNA can form triplexes, where a third strand of the right sequence fits into the major groove.…
A: When pyrimidine or purine bases form Hoogsteen pairs with purines from Watson-Crick basepairs in the…
Q: The so-called hypervariable regions (HV1 and HV2) of the human mitochondrial genome are sometimes…
A: HV1 and HV2 are two hypervariable regions found in the human mitochondrial DNA (deoxyribonucleic…
Q: molecular motors
A: Molecular motor proteins: These are a class of molecular motors which move along the cytoplasm of…
Q: Enter title... UV radiation damages DNA by causing... a) frame-shift mutations b) base substitutions…
A: Changes in sequence of DNA is called mutations. These mutation maybe beneficial harmful or neutral…
Q: How can one remedy the effect of pH change due to sterilization?
A: Explanation : During the process of Sterilization, the components of the medium suffer chemical…
Q: Which of the following are thin structures that extend from the surface of the cell and act in…
A: The kingdom Protista includes all eukaryotes that are not animals, fungi, or land plants. Protists…
Q: All of the following apply to Luria and Delbrűck’s mutation theory as tested using E. Coli and T1…
A: The answer is option c. All of the following apply to Luria and Delbrűck’s mutation theory as…
Q: whats the difference between a chromosome, a chromatin, and a chromatid?
A: DNA is genetic material in living organisms that is composed of two polynucleotide stands. It…
Q: 3. Two parental strains with mean heights of 64.29 and 135 cm. respectively were crossed. The F1 and…
A: In statistics, the mean is actually the average of the sum or total of all number's values divided…
Q: Explain the intracellular mechansim of smooth muscle relaxation of agaonist such as mepyrimine and…
A: There are a few important points : Skeletal muscles will be attached to bones by tendons composed…
Q: The skeletons of early fossil Homo and archaic Homo sapiens are marked by very ____ skeletons; this…
A: The cerebral cortex is the part of the brain that consists of the gray matter. The cerebral cortex…
Q: Please draw a concept map using the following terms for regulation Repressor, Inducer, Induction,…
A: There is the regulation of gene expression in bacteria. It can be positive or negative regulation.…
Q: An important evolutionary innovation and a major difference between the limbs of extant lobe-finned…
A: Answer is option 4. i.e Limbs are supported by a single basal bone in tetrapods. So in tetrapods…
Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…
A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…
Q: efine hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: In the body, hormones act as messengers. Endocrine glands release these substances. In order to keep…
Q: In eukaryotes there is not a consistent relationship between the length of the coding sequence of a…
A: DNA is 2.2 m long molecule in human beings. It is converted to mRNA via process of transcription.…
Q: Describe how moisture affects the growth of microorganisms.
A: There are both harmful and non-pathogenic microbes, which are present everywhere. The body can be…
Q: My Planet is called _____________________. It is located in the ___________________. The weather is…
A: Astrobiology It is the study of life in the universe. Understanding life and the nature of the…
Q: In rats, hair color is either gray (G), black (g), or white. The white color is produced due to an…
A: In genetics, epistasis is defined as a non mendelian theory in which the expression of more than a…
Q: How do surface colonies differ from deep or buried colonies?
A: A population of bacterium, fungi, and other microbes growing on a solid agar media are referred to…
Q: The term taphonomy refers to____. a. the classification of organisms in relation to each other b.…
A: Evolution is a steady phenomenon in which transformation of life takes place from simple to complex…
Q: Whare are five general reasons why scientists conduct surveys
A: A Survey is a study of behaviors, opinions, and needs of a particular group of people. In a survey,…
Q: A woman who does not have hemophilia marries a man who is hemophilic. Determine the genotype of both…
A: Hemophilia is a rare blood disorder in which the blood does not clot properly. People with…
Q: What will happen if you FAIL to do the following during bacterial cell staining. a. Smear…
A: INTRODUCTION Staining This is a technique that contrast a biological specimen at microspic level.
Q: Draw a simple schematic of a neuron and label its parts. Where does “information” usually go in and…
A: Neurons are the nerve impulse generating and conducting cells in the nervous system that are…
Q: Do both cardiac and smooth muscle have gap junctions?
A: Introduction Gap junctions are channels that bodily join adjoining cells, mediating the fast change…
Q: What are the basic differences between the streak plate and the pour plate methods of isolation?
A: Introduction: Microbiologists use the streak plate and pour plate procedures to cultivate mostly…
Q: Before we conclude that mirror neurons help people imitate, which of the following should research…
A: Mirror neurons are a particular sort of brain cell which reacts the same way when we carry out an…
Q: Why is it necessary to inoculate the KIA medium all the way down to the bottom of the tube during…
A: Answer : it is necessary to inoculate the KIA medium all the way down to the bottom of the tube…
Q: If a protein is acted on by a protein kinase, in what way does that change the protein’s structure?…
A: Protein kinases play an important function in cellular activation. A key component of activation is…
Q: what was an important development or defining moment in the history of medicine? Why?
A: The past few centuries had developed several revolutionary milestones in modern medicine as well as…
Q: Homo habilus can be characterized as____. a. more robust than P. boisei b. somewhat similar to Au.…
A: The Latin word homo means "man" or "human." To emphasize how closely related this species is to our…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Gene: DNA Polymerase II. Species: Mus Musculus Gene: RNA Polymerase I. Species: Homo Sapiens Gene: Insulin Receptor (INSR). Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR). Species: Homo Sapiens2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?
- Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Gene: RNA Polymerase I. Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR). Species: Homo Sapiens Gene: DNA Polymerase II. Species: Mus Musculus Gene: Insulin Receptor (INSR). Species: Homo SapiensAnswer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept of "depth of coverage" (the number of fragments that cover a particular span of the contig). Where is the greatest depth of coverage? Where is the least depth of coverage? 3. What do the patterned bands represent? 4. Was it easier to assemble fragments that had multiple types of markers vs. just one type? Why? Assembling contigs out of DNA sequences (strings of As, Cs, Gs, and Ts) follows the same principle: instead of using markers, you line up fragments by overlapping DNA sequences.See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.
- Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answerUsing the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and species of the following DNA sequence: TATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATG Gene: Insulin Receptor (INSR), Species: Mus Musculus Gene: Insulin Receptor (INS), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Mus MusculusDNA fingerprinting questions: ( Please label each lane so I know which one you refer to) Please explain vividly so I can understand: •Explain each lane, by analyzing the band pattern and concluding whether it's homozygous or heterozygous for the presence of Alu at the PV92 locus. •Literature states Alu insertions at PV92 locus are most common in the Asian population (+/+) and mostly not found in Europeans, Americans (-/-) Reference: https://www.mediafire.com/file/s3nr36ow4bw4udw/DNA+Fingerprinting.docx/file
- . what are Genome sequencing methods that were used in 2000-2005 , their advantages and disadvantages? 2. What are the genome sequencing methods used in 2022 ,their advantages and disadvantages?Q4. What is the relationship between the bases displayed when the arrow is pointed to the left versus when it is pointed to the right? Q5. Why do you think the bases are displayed in this way in the Genome Browser?EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3