
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question

Transcribed Image Text:Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to
help you identify important features – capitalization does not affect the nucleotide indicated.
5'.atacaATGcATGTCAaCTAcgaagatccgTAGaTAACATtCATatc...3'
a. Underneath that strand write the sequence of the strand of DNA it would be paired with
in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine,
U-uracil and C-cytosine and remember to label the 5' and 3' ends.
b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA
above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure
to indicate 5' and 3' ends.
c. Translate your mRNA into the appropriate protein. Write the amino acid sequence of the
protein using the single letter amino acid below the mRNA sequence in (b) and label the
amino and carboxy terminals
d. Suppose the underlined, bold a were mutated to be a t. Write the new sequence of your
mRNA transcript below and underneath it the new amino acid sequence of the peptide it
encodes.
e. What kind of mutation would that be?
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acidsarrow_forward#29 and #30arrow_forwardTranslate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'arrow_forward
- Determine the complementary DNA strand that would form. Next, write the mRNA that would form from each complementary DNA strand you created (normal and mutated). Remember that adenine in DNA matches with uracil in RNA, thymine in DNA matches with adenine in RNA, and guanine and cytosine go together. Normal DNA strand - CTG ACT CCT GAG GAG Mutated DNA strand - CTG ACT CCT GTG GAGarrow_forwardGive correct detailed Solution with explanation needed...don't give Handwritten answer..don't use Ai for answering this. Don't copy answer anywherearrow_forwardGiven a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education