Q: Describe the ff 1. Trypanosoma
A: Introduction : Protozoa are heterotrophic, eukaryotic, unicellular microorganisms. The cell wall is…
Q: If the frequency of human birth weights were subject to evolution by natural selection, what…
A: Ans- Stabilisation Natural Selection. The Hardy-Weinberg Equilibrium Principle states that the…
Q: How does plant cytokinesis differ from animal cytokinesis? Opposing forces distribute the cell…
A: First of all, we need to discuss about what is cytokinesis in plant and animal cell. So, the…
Q: 1 2. T B Type here to search Required The diagram below represents a cell. Carbon dioxide (CO₂) and…
A: Cell The basic structural and functional entity of every living organisms except viruses and few…
Q: Please write introduction paragraph on the topic about about human germline gene editing using…
A: Successful somatic and germline genome editing is becoming possible thanks to CRISPR/Cas9 and other…
Q: 1) Explain what is the role of PTEN in the regulation of cell cycle/growth and how does it lead to…
A: Introduction The cells are the basic units of the living organisms that take part in various…
Q: What is tissue inhibitors of metalloproteinases (TIMPs) ? How does it play an important role ?
A: Contact inhibition is the process by which cells stop growing when they come into contact with each…
Q: The heart working with blood vessels to transport blood throughout the body is a type of the…
A: The heart is a strong muscular organ that helps pump blood via the blood vessels. The arteries and…
Q: The pattern of growth of any organism is controlled by hormones homeostasis genes anabolic and…
A: Introduction :- Any self-regulating process, such as homeostasis, helps an organism retain stability…
Q: quick burst of energy?
A: Note : As in the questions mentioned above, the answers for 2,4,5,6,7 are already solved and there…
Q: The moray eel and cleaner wrasse story at the beginning of the chapter is an example of which type…
A: The study of the relationships between living species and their physical surroundings to uncover key…
Q: Are Monkeypox and Smallpox the same? What are the similarities and differences? Include in your…
A: Orthopoxvirus is a genus of viruses in the Poxviridae family and the Chordopoxvirinae subfamily.…
Q: Two pure-breeding strains of flies are mated, and the F1 are intercrossed. The first strain has…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase? O…
A: Cell cycle It is defined as all those changes that occur during the cell growth and cell division…
Q: d) If persons A and B have children, what is the probability that their first child will have the…
A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…
Q: Label the parts and indicate the movement of water in and out of the cell
A: To distill anything, we must boil it and condense the vapors in a separate container. Substances…
Q: Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.
A: Pyruvate Dehydrogenase Complex(PDH) is a multienzyme complex that is involved in pyruvate…
Q: The histological preparation presents a parenchymal organ, the surface * layer of the cortical…
A: Introduction: The connective tissue capsule that surrounds the adrenal gland spreads septae into the…
Q: What is a possible function of cytoplasmic streaming in the slime mold? To help distribute and…
A: Introduction : Protists known as slime moulds are saprophytes. Their anatomy is designed for moving…
Q: What is the structure of the lipid?
A: Biological macromolecules are the molecules that are required in enough amount for the body. It…
Q: Which important phenomenon is both inspected during g1 and g2 checkpoints of the cell cycle ODNA…
A: The cell cycle is the progression of a cell via various phases to complete cell division. The phases…
Q: How do the different types of viral hepatitis vary with regard to mode of transmission and severity…
A: Due to over-alcohol consumption or due to liver disease, medications or viral infection can cause…
Q: Based on the ORGANIZATION of neurons, why are some areas of skin more sensitive than others
A: Neurons are the basic structural and functional unit of nervous system. These are capable of…
Q: 4- What are the changes hormones can make in a cell.
A: Hormones are chemical substances/compounds that are secreted by cells of various glands of the…
Q: What is the difference between the metaphase chromosome and telophase chromosome? Metaphase…
A: Metaphase is a stage of mitosis in the eukaryotic cell cycle in which chromosomes are at their…
Q: Relate the role of hemoglobin and insulin in one of the functions of proteins.
A: Introduction : Proteins are large molecules made up of the building blocks known as amino acids.…
Q: What are Human-Made Chemicals and Pollutants ?
A: A material that is present in concentrations that could be harmful to creatures (including people,…
Q: Which characteristic of water makes it a universal solvent? A. O weak bonds B.O polarity G.O…
A: Introduction Almost 75% of the human body is composed of water. About 70% of the earth's surface…
Q: Compare the primary mechanisms used by the sympathetic and parasympathetic divisions to clear or…
A: The autonomic nervous system functions to regulate the body's unconscious actions. The sympathetic…
Q: Question 3 To see the slide at the highest magnification, turn in between the 40x and 100x and add…
A: Introduction :- Magnification is the process of enlarging something's apparent size rather than its…
Q: Column A 123 1. 2. 3. 4. 5. 6829 7. Reticulum (ER) 6. -Golgi apparatus 8. - 9. Centrioles Chromatin…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 2c) If the whole potoroo genome is 4.2 x 10' bp, and the highly repetitive DNA in the potoroo genome…
A: Whole potroo genome : 42 bp The highly repetitive DNA in the potroo genome is 5'AAGACT' So six bases…
Q: What is the difference between the metaphase chromosome and telophase chromosome? O Metaphase…
A: Metaphase is the phase of cell cycle where the chromosomes appear as sister chromatids and align…
Q: How can bright field and dark field optical microscopy be used in characterizing materials? What…
A: Most of the cells are too small to be detected by unaided human eye. The development of microscope…
Q: Which of the following exert their cell signaling ability proteteolysis of other proteins? multiple…
A:
Q: What is the relationship between cholecystitis and cholelithiasis?
A: Gallstone disease is the most common disorder affecting the biliary system, which is the body's bile…
Q: Can lung cancer deaths be linked totobacco smoking ?
A: The most well-established contributor to lung cancer and other disease processes is still tobacco…
Q: How has the study of human biology and variation in this class changed how you think about race and…
A: Introduction The study of humans through the influences and interactions of many different academic…
Q: coding strand A mutated sequence of DNA CA C GA AT TAGAT GG 5' 3, 5' C T AT GT G C T TA ATC TAC C…
A: Coding strand of DNA:- The DNA strand present in the direction of 5' to 3' acts as coding strand.…
Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…
A: The simplest definition of gene expression is the production of the gene's complementary protein,…
Q: Illustrate the development of colorectal cancer ?
A: Any of the several illnesses characterised by the growth of aberrant cells that divide out of…
Q: What are the anterior and posterior pituitary hormones, their target tissues, and their negative…
A: The hormones are the chemical messengers in our body that are produced by the various glands. There…
Q: Here are some key traits that distinguish the three domains of life (some of which are from the…
A: Classification: It aids in the identification of living creatures as well as the comprehension of…
Q: 1. Read through each procedure below and BRIEFLY describe the procedure in one-two sentences. Be…
A: Answer : Reducing sugars are any carbohydrates that contain a free aldehyde or ketonic group that…
Q: Which set of facts is true for vaccines? They produce active immunity. They are mostly targeted…
A: A vaccination is a biological preparation designed to impart acquired immunity to a specific…
Q: Why is translocation important to plants?
A: The transportation of the substances are carried out by the vascular system of the plant and that…
Q: You have mutated Trypsin by replacing Asp 189 in the specificity pocket with Arginine. Which…
A: Trypsin is a proteolytic enzyme that cleaves at the carboxy terminus of lysine and arginine.Remember…
Q: The image of these living HeLa cells are most likely from:
A: Different types of microscopy are used in the magnification and imaging of cells. Some routinely use…
Q: How does the cell membrane help maintain water content homeostasis?
A: Introduction To attain balance, the body is continually attempting to control its internal…
Q: What is the difference between the metaphase chromosome and telophase chromosome? Metaphase…
A: Introduction The term chromosomes defined as a thread-like structures present inside the nucleus of…
Q.3 How far apart in seconds are the twitches from each other in the recording above?
Step by step
Solved in 2 steps
- What is the approximate amplitude in mV of the twitch in recording B? Be careful and note the position of the baseline! In which recording, A or B, is the amplitude of the muscle twitch measured correctly? In which recording, A,B, or C, is the time between the second two twitches measured correctly?What do these results tell you about when and how much you use your extensor muscles?How are contractions timed? Include frequency, duration and list 3 intensity levels of contractions. How is the intensity of the contraction assessed?
- Which periodization model alternates upper- and lower-body workouts throughout the week?2 of 10 What term is used to describe two exercises performed back-to-back in rapid succession with minimal to no rest? Giant set Circuit Superset Interval Next ▶What causes the variation of the measurements for the periods (latent, contraction, relaxation periods) for the different twitches?
- How does varying the frequency effect contraction force? Which interval caused the greatest contraction?Is there a difference in the time interval from the end of the T wave to the peak of the next R wave during rest and exercise? What does this mean?What additional skeletal muscles are utilized in an ERV activity?
- Is there a difference in the time to fatigue of the dominant and non-dominant arm? Cite relevant experimental data.Does flexion or extension of the individual muscles affect the strength of EMG activity in either the Pronator or Biceps muscle during simulated arm wrestling?Aside from measuring the pulse, what other processes could have measured to determine the external and internal effects of exercise on the body?