Protein concentration can readily be determined using the Beer-Lambert law: A = e l c where A = absorbance e = molar absorption coefficient (M-1cm-1) l = light path length (cm) c = concentration (M) If the molar absorption coefficient at 280 nm for yeast ADH is 48860 M-1cm-1 and a 10 mL solution of the protein has an absorbance at 280 nm of 0.4 (as measured by a spectrometer with pathlength 1 cm), then what is the concentration of the protein solution (in μM)? i.e. concentration = ______ μM   If the molecular weight of the protein is 36849, what is its concentration in mg/mL? i.e. concentration = _______ mg/mL For each part of the question, show your calculations to arrive at your answers.

The α-amylase (α-AM) enzyme secreted by Aspergillus has an isoelectric point of approximately 4.2. If the purification method in problem 1 operates at pH 6.5, would the protein carry a positive charge, negative charge, or net zero charge?

How can I calculate the unknown protein please

Please draw titration curves for peptide HFDTYA and HEKDGQ, and calculate the pl for each. Usethis information to explain why the peptide HFDTYA has low solubility and HEKDGQ has a highersolubility in bulk water at pH = 7.

The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with IAEDANS acceptor. Estimate the length of the protein (head to tail) if the efficiency of RET measures at 0.01 Please show step by step and how to get the 34.014 number

Calculate θ for a certain protein-ligand pair when the ligand concentration = 1 M and the Kd = 1 X 10-15 M.

stock aliquot - 1mg/ml  use the sequence below to determine the molarity using ExPASy Translate and protProt Program   atgggcgaggagtataaagttgtcctcacatttggatccccaatgagccctaatgcaaataacaaacagacttgggttaataaacctcttgatgcgccttcgggccattacaatgtgaaaattgcaaaggatgttgaccactatctaaccatgcagggtttcacttctatagcatctgttgactggtacactatagattttcaaccatctgaggcgcctgccccgataaaaggcttgcaggtacttgtgaacatctcgaaaaaagctgatgtgtatgccgtcaaacaatttgtcacagcgcagaccaacaacaagcaccaggttacaagcctgttcctagtaaaagtaacaactggttttcaggtgaacaactacctgagttacttttacagggcgtctgctactggggatgccacaactaacctgttggttagaggagacacatacacagcagggataagttttacccagggtggatggtatttgttgacaaatacatctattgttgatggggctatgccacctggctgggtctggaataacgtggaacttaaaactaacacagcgtatcacatggacaaaggcttggtccatctaataatgcctttgcctgagtccacgcaaatgtgttatgagatgctgacatctattccagcggccgcagagctcgctctggtgccacgcggtagttccgctcatcaccaccatcatcaccatcaccaccact

A purified protein fraction has a total sample volume of 360 µL.  The sample has a corrected A280 of 0.484, and the blank corrected A280 was 0.052.  (Both values were measured with a path length of 1.00 cm.)  If 5.00 µL of the sample was used in a reaction, calculate the mass of protein in the reaction (in µg).