Practice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.

Practice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.

Name: Practice HW make a nucleotide sequence (Template strand and Coding str
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Practice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and sto

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

Where do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNA
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2: Guanine and Cytosine are purine bases ANSWER: STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase ANSWER: STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter ANSWER:
Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' 5' 5° 3' Label the coding strand and template strand below: A protein is 285 amino acids long. The cell needs 10,000 copies of this protein. Based on this information please answer the following questions. How many ATPS will be needed to make this protein? How many moles of glucose will be needed to make this protein?
Select TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer. 2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways. 3. The coding strand of DNA is complementary in sequence to the corresponding MRNA. 4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation. 5. Polyribosomes speed up the rate of transcription.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Please answer fast Determine the amino acid sequences for the six open reading frames for this 9 nucleotide sequence: 5'-AAATTTGGG-3'
Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
EXERCISE 1 MUTATION Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the amino acid sequence for the following strand of DNA: AGCAATC CGTCTTGG TCGTTAGGCAGAACC That strand has mutated. It is now AGCAACCCGTCTTGG TCGTTGGGCAGA ACC Use your knowledge of mutation and protein synthesis to answer the following questions. 1. What mutation has occurred? 2. Will this mutation have a real effect? Why or why not? (Hint: You may want to try Exercise 10 from Lab 2 again, using the mutated DNA strand to make the mutated protein.)
Exercise 15. What is the resulting amino acid sequence from the parent DNA double helix as follows? - 5' 3' - AAG ACC CT T T 5'- TT CT G G G A A A A ACT A AGT T GA T T C A - 3' b. If the C at the 5th DNA base (3'5' strand) was deleted, what is mutated mRNA and the resulting amino acid sequence? TA
Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome