Exercise 15. What is the resulting amino acid sequence from the parent DNA double helix as follows?- 5'3' - AAG ACC CT TT5'- TT CT G G G A A A AACT A AGTT GA T T C A- 3'b. If the C at the 5th DNA base (3'5' strand) was deleted, what is mutated mRNA and the resultingamino acid sequence?TA

The first step in decoding genetic messages is transcription, during which a nucleotide sequence is…

Exercise 15. What is the resulting amino acid sequence from the parent DNA double helix as follows? 3' - A A G А С С ст Т Т ст T T - 5' 5'- ACT A AGT A T GA T тс A G G G A A - 3' b. If the C at the 5th DNA base (3' → 5' strand) was deleted, what is mutated mRNA and the resulting amino acid sequence? TA A

Exercise 15. What is the resulting amino acid sequence from the parent DNA double helix as follows? 3' - A A G А С С ст Т Т ст T T - 5' 5'- ACT A AGT A T GA T тс A G G G A A - 3' b. If the C at the 5th DNA base (3' → 5' strand) was deleted, what is mutated mRNA and the resulting amino acid sequence? TA A

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
EXERCISE 1 MUTATION Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the amino acid sequence for the following strand of DNA: AGCAATC CGTCTTGG TCGTTAGGCAGAACC That strand has mutated. It is now AGCAACCCGTCTTGG TCGTTGGGCAGA ACC Use your knowledge of mutation and protein synthesis to answer the following questions. 1. What mutation has occurred? 2. Will this mutation have a real effect? Why or why not? (Hint: You may want to try Exercise 10 from Lab 2 again, using the mutated DNA strand to make the mutated protein.)
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?
Practice Complementary Base Palring Indicate the correct base order for the complementary DNA strand by placing the correct label in each indicated base locatio Adenine Thymine Cytosine Guanine Reset
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5
32/ What molecules thought to have performed double duty as a genetic materal and performing catalyss of chemical ARNA B proteins C polypeptides D DNA E both proteins and polypeptides
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب