Pattern recognition receptors bind to Select one: a. B and T lymphocytes b. Host cell-associated molecules c. MHC I molecules d. Pathogen-associated molecular patterns

Q: In a species of tree, seed color is determined by four independently assorting genes: A, B, C, and D...

A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...

Q: What is the Solubility Properties of Annatto Seeds?

A: Annatto seeds are derived from Bixa orellano tree,native to tropical regions.Annatto seeds are used ...

Q: Which o f the following will drastically increase resistance of blood flow?       1000 miles of blo...

A: Ans)If we took all the blood vessels out of an average child and laid them out in one line, the line...

Q: B. Make a punnet square for the following and give the phenotypic and genotypic ratio: 1. One homozy...

A: Answer 1-  the cross between :  GG x gg     G g G GG Gg g Gg gg   The phenotypic ratio of ...

Q: В A

A:     Answer   

Q: Sponge archeocytes can differentiate into A. eggs (oocytes) B. sperm C. choanocytes D...

A: Sponges are organised at a cellular level. They don't have any features that may be classified as or...

Q: Which of the following best describes an emergent property? Group of answer choices a property that...

A: The organ system is a very complex creature made up of several systems. Each system in the body has ...

Q: Insects are attracted to the flower of plants. When they rub against parts of the plant, they carry ...

A: The transfer of pollen grains(carrier of male gamete) from anther to stigma is known as pollination....

Q: How to explain spinal cord injury healing to nonmedical person?

A: Spinal cord is a thread like structure which is a bundle of nerves. This thread like structure is pr...

Q: What long-term effects can gene flow have on any two populations that are exchanging genes?

A: SOLUTION Long term effects of gene flow between two populations exchanging genes will be  the alleli...

Q: Explain in detail difference between homothalism and heterothalism

A: Aspergillus species are homothallic fungi, while Saccharomyces cerevisiae, Aspergillus fumigatus, As...

Q: Is there a connection between the regeneration of fish scales to its survival? If there is, then wha...

A: Regeneration:- Many different parts of the fish’s body will grow back. Plucked scales are promptly r...

Q: 4. An X-linked dominant trait with an unaffected mother and an affected father.

A: X linked dominant  This type of Inheritance refers to the mutations in the genes that are present on...

Q: What's the difference between natural and artificial flavors?

A: Introduction  A food flavoring or flavoring, often known as flavoring or flavouring, or fragrance, i...

Q: If you were the professor reading that essay answer, what sort of grade would you assign, and why?

A: When students are asked to write an essay explaining how to distinguish between an animal cell and a...

Q: Discuss the nucleus in anatomy and explain its immense functions.

A: Nucleus is the control center of the cell . It consists of genetic material which determines the ent...

Q: Chapter 11 Antimicrobial Drugs 435 438 Chapter 11 Antimicrobial Drugs ve 2. Which antibiotic work fo...

A: Vancomycon works for Staphylococcus. Vancomycin , a glycopeptide antibiotic that inhibits cell wall ...

Q: What are some new, simple, and unique transgenic organism in today’s time that can be useful

A: In animals, kingdom different phylum is present like Chordata, Hemichordata, Echinodermata, Mollusca...

Q: 12. Interpret the following table, where s is the selection coefficient for heterozygote advantage i...

A: Answer: In population genetics, a selection coefficient, usually denoted by the letter s, is a measu...

Q: Part C: Co-dominance Cross Practice 5. An example of codominance is coat color in cattle. Cattle whi...

A: Introduction A link between two variants of a gene is known as codominance. Each parent gives each c...

Q: - What is a pure culture? - Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will ...

A: A missense mutation occurs when a single base pair is changed, causing a different amino acid to be ...

Q: All the following are functions of the skin EXCEPT: O protection of underlying tissues regulation of...

A:

Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry o...

A: A virus is a small collection of genetic code, it can be  DNA or RNA, surrounded by a protein coat ,...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...

A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...

Q: Microtubules and microfilaments are similar in that: Group of answer choices A. both use GTP as the...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: If the parent diploid cell starts with 12 Chromosome and undergoes mitosis, then how many will the d...

A: Cell division is a process by which cells multiply themselves and it involves both cytoplasmic and n...

Q: Review of the Anatomy and Physiology of the brain Fil out the table below Section of the brain (fore...

A: Human brain The brain is the central information processing organ of our body and acts as as the 'c...

Q: Most dietary fiber is absorbed in the small intestine?

A: What are dietary fiber- Dietary fiber are the form of plant-derived food that cannot be completely b...

Q: mtDNA is Select one: a. Double stranded linear DNA molecules b. Single stranded circular DNA molecul...

A: Introduction :- Mitochondrial DNA (mtDNA) has a number of unique characteristics, such as a high cop...

Q: The spindle apparatus is formed during the __________ phase of mitosis A. Anaphase B. Metaphase C. P...

A: Mitosis is a type of cell division in which the parent cell divides into two new daughter cells. Eac...

Q: Do you think it is important to identify the diversity of fungi inhabiting the soil and other types ...

A: In ecosystem fungi are important decomposers. Fungi broke down dead plant and animals into smaller m...

Q: HAT48 is a histone acetyltransferase that binds DNA next to the promoter of the OVU3 gene. Likely, H...

A: Acetyltransferases are the enzymes that catalyze the transfer of acetyl groups. Histones are the pro...

Q: Jane is considering switching to a stricter vegan diet. You would suggest she pay attention to the p...

A: Answer- Option D. Minerals

Q: After a long excursion in the tropics you came back  with multiple soil samples from different local...

A: ISOLATION OF ANTIBIOTIC PRODUCING FUNGI FROM DIFFERENT SOIL SAMPLE:  1.COLLECTION OF SAMLPLE:  soil ...

Q: Structures in order as it relates to the pathway of blood flow through the heart/body after is leave...

A: The oxygenated blood from the lungs are sent to the heart via Pulmonary Vein which drains the whole ...

Q: Why "cellulose is composed of a long, branced chain of B-glucose subunits" is false?

A: Introduction Polysaccharides, also known as polycarbohydrates, are the most common type of carbohydr...

Q: What is one statement that would support the theory that all organisms are related? A) The genetic...

A: In addition to being degenerate, the genetic code is also called to as 'unambiguous,' implying so ea...

Q: Use the diagram below to answer Questions #2-4. 2. Draw arrows between the organisms to show how ene...

A:

Q: All of the following were unique challenges that life on land presented to land plants, E O Lack of ...

A: Plants are adapted to life on land by development of many structures like water repellant cuticle , ...

Q: I learned that the base pairs for DNA are and and the base pair of RNA are and I learned that togeth...

A: Introduction:- Under normal circumstances, the nitrogen-containing bases adenine (A) and thymine (T)...

Q: With what region of the promoter does the the principal interaction between it and the RNA polymeras...

A: The process associated with synthesizing ribonucleic acid from DNA can be described as transcription...

Q: For hemoglobin, when there is an increased concentration of CO2, this will result in a lower P50 val...

A: ANSWER;- 1)False Explain;- For hemoglobin, there is an increased concentration of CO2, this will res...

Q: The job of a ribosome is to?

A: Answer   

Q: 1. IDENTIFY THE EPITHELIUM. 2. IDENTIFY THE POINTED STRUCTURE. 3. WHAT GROUP OF EPITHELIUM DOES IT B...

A: Epithelium  -- The term epithelium refers to layers of cells which line hollow organs and glands . T...

Q: Which group is the least related to humans? Name two organisms that don't form a clade together. Exp...

A: The phylogenetic tree is called an evolutionary tree. The tree represents the evolutionary relations...

Q: How did the authors arrange that Mfn2 was only upregulated in the brain and spinal cord of TMFN mice...

A:

Q: How does fluoride and salts in tap water results in plant necrosis?

A: Necrosis  Necrosis is the death of tissue due to disease or environmental stress.

Q: Where would an organelle properly be placed on this list? atom, compound/molecule, macromolecule, ce...

A: From small to large, living things are highly organized and structured.The biological level of organ...

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.