omicron sub variants

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: What type of rotational (cyclic) symmetry is apparent in the structure? O Six-fold. O Seven-fold. O…

A: SARS COV-2 belongs to the coronavirus family. It has many proteins that form the complete structure,…

Q: what carries genetic information

A: Genetic information includes information about an individual's genetic tests and the genetic tests…

Q: Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the significant…

A: The major changes that are represented in the evolution of prokaryote cells into eukaryote cells…

Q: What must two different bacteria have in common for the same bacteriophage to be able to kill both…

A: A phage commonly known as bacteriophage is a type of virus that infects bacteria. The word "phage"…

Q: Modern maize is derived from teosinte, a weedy plant that grows in South and Central America. A key…

A: The question relates to the hereditary evolution of maize from its precursor, teosinte. The tb1 gene…

Q: In January 2012, a physician in a Buenos Aires hospital telephoned the Ministry of Health (MOH) to…

A: We'll answer the first question since the exact one wasn't specified.Please submit a new question…

Q: Treatment and Intervention for Covid-19 Therapeutic and Medical Managent Nursing Managment

A: Covid 19 is an infectious disease caused by the severe acute respiratory syndrome coronavirus 2. It…

Q: Suppose you are a lab technician who is responsible for diagnostic analysis of individual…

A: Thalassemia is a rare inherited disorder in which the body possesses lower-than-normal levels of…

Q: Question #1: In 1966, a mouse was found in the Jackson Laboratory colony that seemed to be excessive…

A: One of the most used animal models for researching type 2 diabetic mellitus (T2DM) is the db/db…

Q: Sanger Sequencing Questions Q5. What are the applications of this sequencing technique? Q6. Draw the…

A: The DNA is made of four different types of nucleotides connected with a phosphodiester bond formed…

Q: What are the structures contained in the pointed area?

A: Histology is a science that studies the tiny anatomy of biological tissues. It is also recognized as…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: the image is the steps for help. Not writing assignment!!!! What is the intended outcome of the…

A: Lysozyme based ion exchange chromatography= Lysozyme is a enzyme which is formed in body naturally…

Q: When or why is this genetic technology/process used? Who benefits from this genetic…

A: Recombinant genetic technology is the process of combining nucleic acid (DNA) of two different…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: Why are host cell antiviral responses that target double-stranded RNA effective against single-…

A: The host cell's antivirus response against RNA viruses target enzymes used by RNA virusesto stop…

Q: Paraphrase and add more information "This study will concentrate solely on the molecular…

A: Seaweed, also known as marine macroalgae, is a type of aquatic plant that grows in the ocean or…

Q: Diagnosis of covid-19 What are some future diagnostic approaches?

A: Viruses are intracellular parasites and require a suitable host for their genome replication. The…

Q: Help me, please! I wish I have a lot of time to do it by myself ... This is the article link and a…

A: An epidemic occurs when a disease spreads rapidly to a large number of hosts in a population in a…

Q: Some scientists have concluded that this method of gene therapy will be a more effective long-term…

A: Hematopoietic stem cell transplantation (HSCT) involves the intravenous (IV) infusion of autologous…

Q: Q1.5. What is the postmortem age of the body located middle right? 112.2 hours Check Answer Q1.6.…

A: The linear best-fit line graph is provided along with relevant information for the calculation of…

Q: 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted D…

A: 1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…

Q: 5. Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins?…

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…

Q: thank you and hava a nice day :) Article: Can Nanotechnology Help to Control the Cytokine Storm?…

A: This article is about covid-19 pandemic and how it is responsible for killing so many people. The…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: 4. You want to perform a sequential double digestion of a 9000 bp plasmid to see if a 450 bp insert…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions that make each…

Q: What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

A: In eukaryotes, they are made of DNA and a membrane-bound nucleus. The eukaryotes make their own…

Q: (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention…

A: INTRODUCTION Three different method of horizontal gene transfer Transformation, Transduction and…

Q: 5. A DNA sequence of "ACG" will code for the amino acid First mRNA base (5' end of codon) U G UUU…

A: A codon is a sequence of three nucleotides in a messenger RNA (mRNA) molecule that specifies the…

Q: Assuming there are colon tumor samples, one from a HNPCC patient, and the other from a FAP patient.…

A: Answer) HNPCC has mostly normal karyotype.   Hereditary Nonpolyposis Colon Cancer (HNPCC):  It is…

Q: Please answer ASAP:   What is Shine-Dalgarno sequence? In which groups of microorganisms it is…

A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…

Q: Under what conditions, a higher rate in the presence of the inhibitor observed? (how could the…

A: There is a gradual increase in reaction rate because competitive inhibitors are occupying only some…

Q: Question 1: A. In Northern blotting, electrophoresis is used to resolve which biological molecules?…

A: * Northern blot is a laboratory method to detect RNA molecules in a  mixture of RNA. *It is used to…

Q: G Irradiance (1, HE m2 s¹) 10 25 50 100 250 500 W Question 3. (/9) a) Sketch the photosynthesis (P)…

A: Answer :  For plotting the graph of Diatom Photosynthesis(P) vs Depth(z); the data table is given is…

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: Can you summarize and explain for me what you want to tell in the article below? When I read it…

A: The above article describes about the Interference with Cellular Uptake, Immobilization, and…

Q: SARS-CoV-2 what is the genome for the virus? And, what Baltimore class does the virus belong to?…

A: 1. The genome of SARS-CoV-2 is an ss RNA virus composed of 13–15 ORFs that code for 27 different…

Q: Passage 3 "You know I never thought I needed to take a multivitamin because I am healthy and I eat…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: Enucleation Breakdown in the following order and be sure to label (e.g. Suffix) each word part 1. S)…

A: Suffix is an affix that is added to the end of a word to form a new word. Prefix is an affix that is…

Q: What is Big Bang Theory? (Please, the answer should be related to  NCERT Biology if possible)

A: Ncert  plus two biology text chapter 7 , evolution talks about big bang theory .

Q: Question 5. Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the…

A: With fossil evidence reaching back to over 3.5 billion years ago, prokaryotes are one of the oldest…

Q: QUESTION- There is an RFLP pattern that belongs to a disease. I need to find an inheritance pattern…

A: The RFLP stands for the restriction fragment length polymorphism. It is the molecular biology…

Q: Bacteria of the genus Mycoplasma have among the smallest known genomes for a free-living cell (only…

A: Mycoplasma Genomes:Mycoplasma is a type of bacteria with a very small genome, containing only 525…

Q: Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger…

A: Sickle cell anemia is a genetic disorder affecting the structure and function of hemoglobin, a…

Q: Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome…

A: Genes give data to building proteins. They don't anyway straightforwardly make proteins. The…

Q: Please introduce how to obtain a nucleotide sequence of unknown viruses. Please give me a detailed…

A: Nucleotide sequences are long chains of nucleotides. These chains form the basis for DNA and RNA –…

Q: Σ P UTF-8"Chapter 12 Solutions 202 x…

A: Isotonic- same solute concentration. Hypertonic-  higher solute concentration in outer environment…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.