QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the gene is show below: 3' 5' ATGAATACAAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTTTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' The modified sequence is shown below, with the mutation highlighted in bold: 3' 5' 3' 3' ATGAATACATAACGTTCCAATATTCAGTTCTCCGGTCAGAGATTTACCAAGGTCTTTCGAA TACTTATGTATTGCAAGGTTATAAGTCAAGAGGCCAGTCTCTAAACGGTTCCAGAAAGCTT 5' Q2: What effect will this mutation have on Gal1 expression? There will be no effect O Gal1 will always be ON O Gal1 will always be OFF O Gal1 will be expressed only when galactose is present in the cell O Gal1 will be expressed only when galactose is absent from the cell QUESTION 10

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.