Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps
Follow-up Questions
Read through expert solutions to related follow-up questions below.
Follow-up Question
Part C of the question was not answered.
Solution
by Bartleby Expert
Follow-up Questions
Read through expert solutions to related follow-up questions below.
Follow-up Question
Part C of the question was not answered.
Solution
by Bartleby Expert
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Please type clear answerarrow_forwardThis is the pre-mRNA of a mammalian gene with the spice sites marked. 5’-AGCUUCGCGUAAAUCGUAG/GUAAGUUGUAAUAAAUAUAAGUGAGUAUGAUAG\GGCUUUGG ACCGAUAGAUGCGACCCUGGAG/GUAAGUAUAGAUAAUUAAGCACAG\GCAUGCAGGGAUAUCCU CCAAAUAG/GUAAGUAACCUUACGGUCAAUUAAUUAG\GCAGUAGAUGAAUAAACGAUAU CGAUCGGUUAG/GUAAGUCUGAU-3’ This is the spliced mRNA with the spliced sites marked with a vertical line, “|”. 5’-AGCUUCGCGUAAAUCGUAG|GGCUUUGGACCGAUAGAUGCGACCCUGGAG|GCAUGCAGGGAUAUCCU CCAAAUAG|GCAGUAGAUGAAUAAACGAUAUCGAUCGGUUAGGUAAGUCUGAU-3’ Translate this mammalian mRNA into the correct amino acid sequence. In your answer, use the three letter abbreviations for each amino acid.arrow_forwardBelow is a segment of RNA, transcribed from a DNA sequence. Use the codonchart to help answer the questions below. 5’ AUG/CCU/ACG/GAC/UGG/CCU 3’ a. What polypeptide would be generated by this sequence? b. The RNA is mutated to: 5’ AUGCCCACGGACUGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. c. The RNA is mutated to: 5’ AUGCCUACGGACGGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. d. The RNA is mutated to: 5’ AUGCCUACGGACUGACCU 3’. What type of mutationhas occurred? Show the new polypeptide chain.arrow_forward
- Please asaparrow_forwardUse the graph to identify the most likely consensus sequences. Assume this is a prokaryoticcell, label Pribnow boxarrow_forwardFigure out the mutation. You will need the codon table for this question. WT genomic sequence of a really small gene and matching complete amino acid sequence of its gene product. GGT ATG GGG ACT TTG AGG ATG ATA AGG CGT AAA TAA ATAT Met Gly Thr Leu Arg Met Ile Arg Arg Lys A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the likely mutation? between T14 and G15, insert T. G7 -> del. T5 -> del. G29, T30, A31 -> del between T14 and G15, insert AA. A31 -> T. C11 -> delarrow_forward
- 1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 ATGAAGCTAC 51 TTTGCCCAGG 101 ACATCTGACA 61 TTTGACAGTC TTCTATCGAA CAAGCATATA ATCAGCGATA 71 111 31 121 AGGTTTAACA ACATGTCAAG TGCTCCAAAG AAAAACCGAA 81 141 GGGAAAAAAT CCCCCCCCCC TTTTTTTTTTTTTTTTCCCG d. Where is the 3' UTR? Circle one. 12-72 35-72 131 109-146 41 a. Write the corresponding sequences, circle & label them in the sequence above: -35 consensus sequence: (label as -35) -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: (label as PB) 91 c. What will be the nascent polypeptide sequence translated from this mRNA? (label as SD) (label as start) b. What region of this prokaryotic DNA sequence will be transcribed into mRNA? Circle one. 1-120 35-108 54-146 72-146 (label as stop) 121-146arrow_forwardThe following sequence contains the first couple codons from the Moderna vaccine mRNA. Below it are versions of the same sequence, but each of these contain a mutation. Match these mutated sequences with the correct mutation type a b C d Original sequence AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC UAG UGC GUG AAC CUG AUG UUC GUG UCC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCA CUG GTG AGC AGC CAG UGC GUG AAC CUG AUG UUC GUG UUC CUG GUG CUG CUG CCC CUG GTG AGC AGC CAG UGC AGU GAA CCU 1. Synonymous 2. Nonsense 3. Non synonymous 4, Frameshiftarrow_forwardPlease answer asap and in short and content should not be palgarised please For each of the following RNA molecules: Indicate if it is Required or Not for translation in prokaryotes and, if it is required, what does it do? mRNA tRNA rRNA snRNAarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education