N C N HC C GH CH N H Which base normally pairs with this structure: a. Thymine b. Adenine c. Cytosine d. Guanine

Q: nt #2 nt #3 nt # 4 3. In the following sequence, which of these nucleotides a. would have a free…

A: a) Nucleotides #1 and #5, because the 5’ end of each DNA strand has a triphosphate group.

Q: DNA in the form of a double helix must be associated with cations, usually Mg²+ . Why is this…

A: DNA is made up of two strands wind around one another to form double helix. The two strands are…

Q: Draw a tripeptide only containing Alanine

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: nucleoside is composed of a) a base+ a sugar b) a base+ a sugar+ phosphate c) a base+ a phosphate…

A: Nucleotides and nucleosides make up nucleic acids (DNA and RNA). Both nucleotides and nucleosides…

Q: Which of the following exhibit(s) the "quaternary" structure of nucleic acids? a.ribosome…

A: Quaternary structure of nucleic acids refers to the higher-level organization of nucleic acids,…

Q: are located on the inside of the helix, and the ii are located on the outside, facing towards the…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction  A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: n as1 mutant, assign secondary structure and tell how many alpha helices and beta-pleated sheets…

A: Primary Structure: It is defined as a linear sequence of amino acids joined to each other through a…

Q: Which of the following sequences is most likely to form an a helix?

A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: What do you mean by myristylated N-terminus?

A: N-myristoylation is the process in which myristic acid is attached to N-terminal glycine. It occurs…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…

A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…

Q: The amino acids leucine and threonine in general tolerate being in an alpha helix. However having…

A: α-Helix is formed by the hydrogen bonding between the backbone atoms of the polypeptide chain or…

Q: The following are all true of RNA, excepta. it is a single-stranded molecule existing in helical…

A: Friedrich Meischer discovered nucleic acids from the nuclei of pus cells and coined the term…

Q: Bidentate interactions are those where two or more hydrogen bonds are made with a base or base pair.…

A: Introduction  A base pair is a fundamental building block of double-stranded nucleic acids made up…

Q: Express the following DNA nucleotide bases into amino acids.

A: DNA is first transcribed into mRNA and then translated to amino acids.  In transcription, it follows…

Q: On which of the following amino acids is an N-linked glycan added to? A.Asparatic acids…

A: Basic amino groups (-NH2) and carboxyl groups (-COOH) are found in amino acids. Proteins have amino…

Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…

A: Metalloprotein linkages are most likely to be formed between?

Q: An amino acid is connected to the t-RNA by which of the following functional groups? a. Ester b.…

A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…

Q: The formation of deoxyribonucleotide from ribonucleotide requires all the following except:…

A: A nucleotide is the basic part of nucleic acid that contains nitrogenous bases (adenine, thymine,…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: In the early days of molecular biology, some researchers speculated that RNA, but not DNA, might…

A: Molecular biology is the field of biology that studies the composition, structure, and interactions…

Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Provide an explanation for why in DNA, the base G is always base paired with C and A is always base…

A: DNA is a double layered structure. The double helix model is explained by Watson and Crick. The two…

Q: Which of the following would explain the formation of double-stranded loops in tRNA? A.…

A: tRNA stands for transfer RNA. It is responsible for transferring the amino acids from cytoplasm to…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: Draw a peptide bond between Phenylalanine (c-terminus) and Isoleucine (n-terminus).

A: Amino acids are organic compounds with two functional group namely carboxyl and amino. There are 20…

Q: Consider a protein with the following amino acid sequence: -R-V-G-M-A-E-I-Q–V–L-K-F-V-I-H–L- Which…

A: The 2° (secondary) structure of the peptide chains can be determined using the Chou-Fasman algorithm…

Q: What needs to happen to the polypeptide to form a protein?

A: Proteins are called the building blocks  of life. They are important biomolecule made up of amino…

Q: Discuss the differences between the Z-Form, A-form and B-form Dna

A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…

Q: Name four differences between the structure of DNA and RNA.

A: Introduction :- Ribonucleic acid (RNA) is a nucleic acid found in all living cells that is…

Q: An alpha helix is a: O A. secondary structure found in proteins. O B. right-handed twist found in…

A: DNA ( Deoxyribonucleic acid) is a nucleic acid. The basic unit of DNA is the nucleotide. DNA is a…

Q: Describe the effect on the protein if the base pair #6 in the parent DNA chain is misted from G/C to…

A: Deoxyribonucleic acid (DNA) is the foremost key genetic constituent of all life forms. It is further…

Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'

A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…

Q: Which of the following would explain the formation of double stranded loops in RNAS? A. electronic…

A: Ribonucleic acid (RNA) is a DNA-like molecule. RNA, unlike DNA, is a single-stranded molecule. The…

Q: In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their…

A: The present knowledge of DNA's function in heredity has resulted in a wide range of practical uses,…