Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a glutamic acid c.A leucine and a phenylalanine d. Two aspartate residues e.A tyrosine and a serine
Q: Use a cost–benefit approach to explain why females whose eggs are destroyed still remain with the…
A: Social animals often form long-lasting relationships with fellow group members, usually with…
Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16
A: Frog muscles: In frogs different types of muscles can be found that help the frog in performing…
Q: The joining of male and female reproductive cells is called?? II. It is the make reproductive part…
A: Plants' life cycles comprise two stages called alternation of generations. The haploid gametophyte…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…
Q: 0.0 1.0 0.0 3 0.0 0.0 1.0 4 0.5 0.25 0.25 5 0.25 0.25 0.5 0.25 0.5 0.25 7 0.33 0.33 0.33 8 0.04 0.32…
A: According to Hardy Weinberg equilibrium- p2+q2+2pq=1 Where, p= frequency of the dominant allele in…
Q: Which of the following is inhibited by increased concentration of NADH? Krebs cycle Pyruvate…
A: Molecules like ATP, ADP, NADH regulate enzymes involved in cellular respiration. In pyruvate…
Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…
A: Introduction The Pasteur effect:- It is an inhibiting effect of oxygen on the fermentation process,…
Q: Calculate the estimated concentration of test agent that inhibit cell growth by 50% ( GI50) value
A: Temozolomide is a drug used to treat certain types of brain tumors. It belongs to a class of…
Q: i need the answer quickly
A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…
Q: To examine: Whether the statement, “The three respiratory enzyme complexes in the mitochondrial…
A: The inner mitochondrial membrane contains three respiratory enzyme complexes that electrons pass…
Q: What is Enterobacter aerogenes? What did Enterobacter aerogenes cause? How do you know that organism…
A: There are wide diversity of microbes present in our surrounding;like virus; bacteria;fungi etc which…
Q: Given the following information about the inheritance of characteristics in pea plants, answer the…
A: 1. Different gametes produced by the female plant= yyRrBbssll Using formula = 2n n= number of…
Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…
A: Answer
Q: A community-based intervention program for hypertension was undertaken in two communities to compare…
A: Given: Hypertension is a prominent risk factor that poses global burden of diseases. It is most…
Q: 9. Which of the following is/are the sign(s) of renal malfunction? I. Renal clearance of creatinine…
A: Urinary system is a type of body system which generally involved in formation of urine and it's…
Q: How much of 9XTBE (in ml) and how much water (in L) do you need to prepare 2 L of 1XTBE? I need I…
A: Given, 9xTBE and water. We need, 2L of 1xTBE solution. We will use the formula, M1V1 = M2V2 M1 and…
Q: 1 2 10 3 11 12 13 5 14 15 6 8 16 Figure 8.1 Muscles in the dorsal side of the frog
A: Soft tissues include muscles. Your muscles are made up of many flexible fibres.
Q: In contrast to our jaws. which move up and down, the mouthparts of arthropods move side to side.…
A:
Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.
A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…
Q: PROVIDE ANTIRAHITICAL ACTIÓN 1. infrared rays 2. visible light 3. ultraviolet rays 4.…
A: There are few important points : Antirachitic action : This is the mineralization zone in which…
Q: Which area(s) of the brain exert(s) control over the autonomic nervous system? cerebrum cerebellum…
A: Introduction Autonomic nervous system:- It is a component of the peripheral nervous system that acts…
Q: How can you protect yourself from diseases that can be acquired from the environment?
A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…
Q: Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph…
A: The living world, as we all know it, can predominantly be divided into - Plants and Animals. Apart…
Q: A galactosidase from E. coli has a molecular weight of 650 000 Da and a molar extinction coefficient…
A: Given values Molecular weight of galactosidase= 650000Da. Molar extinction coefficient (e) = 1.3 x…
Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…
A: Temporal isolation is when species that could interbreed do not because the different species breed…
Q: Positive thigmotropism is a response in plants in which they move and grow toward an object the…
A: Thigmotropism can be defined as a response to touch;It is basically a curvature movement in which a…
Q: Give at least 5 observations from the structures based on fish dissection?
A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…
Q: In cattle, the gene for hornless (H0 is dominant to the gene for homed h), the gene for black (8) is…
A: Given: In cattle, Gene for hornless (H) is dominant to the gene for horned (h). The gene for black…
Q: Describe the way turfgrasses grow. What has influenced their evolution and whatimplications does…
A: Evolution is the change in characteristics of a species over a large period of time over its…
Q: Activity 1: Research 5 similar species with different characteristics. Example: Gartner snakes live…
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
Q: In which of the following situations would you expect to probably see differences in the speed of…
A: ANSWER:- Comparison of nuclear and mitochondrial genes in the same species
Q: It has been established that V. parahaemolyticus cross-reacts with many marine bacteria…
A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…
Q: In which of the following situations would you expect to probably see differences in the speed of…
A: ANSWER;- Comparison of nuclear and mitochondrial genes in the same species Explain;- The most…
Q: Account for the success of parasitic protozoans. Cite specific strategies employed by these…
A: Protozoa are the microorganisms visible under microscope. They are unicellular and Eukaryotic…
Q: How does Red Queen Hypothesis cause an evolutionary race with coronaviruses and mammalian species
A: RED QUEEN HYPOTHESIS - The Red Queen hypothesis was coined in evolutionary biology to explain that a…
Q: 1. Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…
A: Derived traits and Primitive traits Every individual bears some kind of characteristics specifically…
Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…
A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…
Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…
A: autosomal recessive disorder.
Q: Why are new drugs for heptacellular carcinoma necessary? Highlight: - that the risk factors for…
A: Hepatocellular carcinoma or the liver cancer can be treated by several drugs. Moreover, every cancer…
Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…
A: Albinism is a disorder of autosomal recessive inheritance. Albinism inhibits melanin production,…
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…
A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…
Q: The image above represents a simple cladogram for the primate order, where the letters are nodes and…
A:
Q: What are 4 mutualistic and 4 antagonistic interaction between two or more species that are exploited…
A: Four mutualistic interactions- 1. Aphids and ants- Aphids are sap-sucking insects that exude…
Q: Discuss and explain the process on how respiratory system and circulatory system work together
A: The blood circulatory system, is a system of organs that includes the heart, blood vessels, and…
Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…
A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…
Q: Ancient Greece and ancient Rome tried to conserve energy in all of the following ways except: A.…
A: In the shadow of the emergence of human civilization and urban settlements, the history of Ancient…
Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…
A: There are different kind of interactions occurs in diverse organisms in the environment;which affet…
Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…
A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…
Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…
A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…
Metalloprotein linkages are most likely to be formed between:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The mutated form of hemoglobin (hemoglobin S, or HbS) in sickle-cell anemia results from the replacement of a glutamate residue by a valine residue at position 6 in the B chain of the protein. Normal hemoglobin is designated HbA.Phosphorylation is a very common post-translational modication (PTM) to regulate protein function. Which amino acids are most commonly regulated by phosphorylation? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a Leucine, arginine, serine. b Tyrosine, arginine, glutamine. C Serine, threonine, tyrosine. d Glutamine, arginine, tyrosine. e Serine, tyrosine, glutamine.Using the amino acid phenylalanine, draw and specify the nature of each following tertiary structure interactions between:a. two cysteinesb. arginine and glutamic acidc. isoleucine and tyrosine
- Which of the following does cytosine pair with? a. guanine b. thymine c. adenine d. a pyrimidineA heptapeptide was analyzed by Pinky. She reacted it with carboxypeptidase and found out that it reacted with proline. Partial hydrolysis of the heptapeptide gave the following shorter peptides: Tyr-Leu Ser-Arg Tyr-Trp-Ser Tyr-Leu-Pro What is the sequence of the heptapeptide? Input the three-letter codes of the amino acids separated by dashes with no space character (e.g. Arg-Ser-Leu).An American biochemist Erwin Chargaff discovered that in the cells of all organisms he studied, the amount of adenine is always equal to the amount of thymine, and the amount of cytosine is always equal to the amount of guanine. Explain his findings.
- 1. How many different tripeptides are possible? How many carboxyl terminals of polypeptide chains are present in a molecule of hemoglobin? 2. You have isolated a pentapeptide composed of four glycine residues and one lysine residue that resides at the C-terminus of the peptide. Using the information provided in the legend of Figure 2.27, if the pK of the side chain of lysine is 10 and the pK of the terminal carboxyl group is 4, what is the structure of the peptide at pH 7? At pH 12? 3. The side chains of glutamic acid (pK 4.3) and arginine (pK 12.5) can form an ionic bond under certain conditions. Draw the relevant portions of the side chains and indicate whether or not an ionic bond could form at the following: (a) pH 4; (b) pH 7; (c) pH 12; (d) pH 13.Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?Indicate whether each of the following amino acids is polar: a. lysine b. tyrosine c. leucine d. asparagine e. proline f. cysteine g. glutamic acid h. valine i. histidine j. glycine
- Which of the following could be the DNA template for the following protein primary structure. Methionine - Alanine - Asparagine - Aspartic Acid - Phenylalanine - Glutamine - stop O a. 3' TACCGGTTACTGAAAGTTATT 5' O b. 3' AUGGCCAAUGACUUUCAAUAA 5' O c. 5' ATGGCCAATGACTTTCAATAA 3' O d. 5' TACATGTAACAAGACGCCAAT 3"1) what is the net charge of the amino acid leucine of it is on the C-terminus end and why? 2) if the amino acid was changed to lysine on the c-terminus end explain why and what the net charge would be?.You have isolated a new protein called STICKY. You can predict from comparisons with other known proteins that stick contains a bHLH domain. Predict the function of STICKY and rationale for the importance of these domains in STICKY function.