n a pUC19 digest for 1 ug of pUC19 (DNA conc. 282ng/ul) using 10X Cutsmart buffer, pure water and BamHI enzyme in a total volume of 40 ul, how much of each solution is added to the total volume?

In a molecular disease of hemoglobin, Hemoglobin Rainier, Tyr 145β is replaced by Cys, which forms a disulfide bond with another Cysresidue in the same subunit. This prevents the formation of ion pairs that normally stabilize the T state. How does hemoglobin Rainier differ from normal hemoglobin with respect to the Hillcoefficient? Explain your answers.

stock aliquot - 1mg/ml  use the sequence below to determine the molarity using ExPASy Translate and protProt Program   atgggcgaggagtataaagttgtcctcacatttggatccccaatgagccctaatgcaaataacaaacagacttgggttaataaacctcttgatgcgccttcgggccattacaatgtgaaaattgcaaaggatgttgaccactatctaaccatgcagggtttcacttctatagcatctgttgactggtacactatagattttcaaccatctgaggcgcctgccccgataaaaggcttgcaggtacttgtgaacatctcgaaaaaagctgatgtgtatgccgtcaaacaatttgtcacagcgcagaccaacaacaagcaccaggttacaagcctgttcctagtaaaagtaacaactggttttcaggtgaacaactacctgagttacttttacagggcgtctgctactggggatgccacaactaacctgttggttagaggagacacatacacagcagggataagttttacccagggtggatggtatttgttgacaaatacatctattgttgatggggctatgccacctggctgggtctggaataacgtggaacttaaaactaacacagcgtatcacatggacaaaggcttggtccatctaataatgcctttgcctgagtccacgcaaatgtgttatgagatgctgacatctattccagcggccgcagagctcgctctggtgccacgcggtagttccgctcatcaccaccatcatcaccatcaccaccact

A purified protein fraction has a total sample volume of 360 µL.  The sample has a corrected A280 of 0.484, and the blank corrected A280 was 0.052.  (Both values were measured with a path length of 1.00 cm.)  If 5.00 µL of the sample was used in a reaction, calculate the mass of protein in the reaction (in µg).

To prepare a gel sample, you want to load 50 ng total of protein/well. You have added 200 μL of protein in 800 µL reagent and measured your sample by Bradford A595 to be 0.7 mg/mL - your dilution is unaccounted for at this point. Assuming a total final volume of 20 μL, what volume of protein sample, buffer and 4X SDS PAGE Loading Dye needs to be mixed to create a final sample of 50 ng protein in 20 μL?

Suppose you have a concentration of 356ng/uL for Sample A.  How many ng of protein will that be?

Explain what the meaning of these distances is (e.g., from where to where?)Crystal structure of human monocyte chemotactic protein-2

A spheroidal bacterium with a diameter of 1.0 μm (micrometer, 1 μm = 10-6) contains 25,000 molecules of the protein hexokinase. What is the molar concentration of the protein inside the cell?