Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #4 DNA template: 3' TACGCGTGCACGATGCAGTAATACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:
Q: What species of plasmodium causes the worst malaria infections
A: Several factors contribute to the 'severity' of malaria caused by certain 'Plasmodium' species.…
Q: why are cyberattacks in healthcare a challenging issue for healthcare administrators
A: The objective of the question is to understand why cyberattacks pose a significant challenge for…
Q: If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it…
A: The objective of the question is to find out the number of thymine bases in a DNA molecule given the…
Q: Hemophilia is a recessive sex-linked disorder (Xh). A man with hemophilia and a female carrier are…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 1. How do we measure and define evolution? 2. Evolution occurs: 1. at the level of the individual.…
A: Understanding evolutionary biology involves exploring the mechanisms driving the diversity of life…
Q: Following a fracture of the humerus, an adult patient has a biopsy of the healing area. Which of the…
A: The question is asking about the type of bone that is most likely to be seen in a biopsy of a…
Q: to produce four aughter cells. If a nondisjunction of an autosome happens during meiosis I, what are…
A: Meiosis : In this type of cell division a parent cell is divided into four genetically different…
Q: Classify the given items with the appropriate group. Neuron is hyperpolarized Occurs when…
A: Relative Refractory PeriodNeuron is hyperpolarized: This occurs during the Relative Refractory…
Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…
A: The objective of the question is to identify which of the given options is an example of…
Q: Explain the difference between generalized and specialized characteristics. What are examples of…
A: Generalized and specialized characteristics refer to two contrasting strategies that organisms…
Q: Mallard duck production characteristics
A: Mallard duck production involves breeding, incubating eggs, hatching, and brooding. Ducklings…
Q: Please associate the explanation with the correct de-extinction methods, some of which are still…
A: The objective of the question is to match the given de-extinction methods with their correct…
Q: Observation of a hematoxylin and eosin- stained microscope slide reveals that the nuclei are blue.…
A: The objective of the question is to understand the reason behind the blue color of nuclei in a…
Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…
A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…
Q: What do scurvy, brittle bone disease, and the hyperextensibility syndrome have in common?
A: Scurvy, brittle bone malady (osteogenesis imperfecta), and hyperextensibility syndrome (regularly…
Q: What are the three major steps of phylogenetic reconstruction using the parsimony method? Find the…
A: Step 1: Sequence alignment: Aligning the sequences to identify shared characteristics.Step2: Find…
Q: Does RNA have polarity?
A: In molecular biology, the structure and function of nucleic acids are foundational for understanding…
Q: Explain the research methodology, design, and analyses.
A: The research methodology of this study involved analyzing metadata from a large set of peer-reviewed…
Q: Both bison reintroduced to Banff National Park and burrowing owl reinforcement in BC used soft…
A: The question is asking whether both the bison reintroduced to Banff National Park and the burrowing…
Q: Diagram or describe the replication cycle of HIV-1. Indicate all the steps/stages that can NOT be…
A: The replication cycle of HIV-1 (Human Immunodeficiency Virus type 1) is a complex process that HIV,…
Q: Based on base substitution rates, which of the following is likely to be true? P(A/G) + P(A/T)…
A: In molecular biology, base substitution mutations are classified into two main…
Q: Describe how tRNA is charged with an amino acid.
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: What is the difference between primary succession and secondary succession?…
A: The objective of the question is to understand the difference between primary succession and…
Q: A nucleoside consists of a pentose sugar linked to a nitrogenous base and a phosphate group True…
A: There are four types of nitrogenous bases found in DNA, adenine (A), thymine (T), cytosine (C) and…
Q: Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I…
A: The objective of the question is to understand the role of DNA polymerase I in DNA replication and…
Q: 700 600 500 400 300 200 100 30 10 ||| MW III-1 III-2 IV-1 E1 E2 E3 E4 E5 E6 MW= molecular weight…
A: Inheritance of genetic disease could be as follows,Autosomal dominant(if a single parent is…
Q: Select all that apply. Beetles from two geographically isolated populations are captured and brought…
A: If two organisms (of different sex) are capable of reproducing (in the case of sexual reproduction)…
Q: Formulate a short introduction that emphasises the importance of understanding the structure and…
A: By promoting the efflux of alanine, an important amino acid required for several cellular functions,…
Q: The connective tissue is a Tissue that supports, protects, and gives structure to other tissues and…
A: The tissues which are derived from embryonic mesoderm, present throughout the body to support and…
Q: Which of the following cells share a common progenitor cell with macrophages? a)Astrocytes b)…
A: The question is asking us to identify which of the listed cell types shares a common progenitor cell…
Q: Which of the following is NOT true for the speciation of finches in the Galapagos islands? A.…
A: Analyzing Statements about the Speciation of Galapagos Finches:The statement that is NOT true about…
Q: Last word is anterior
A: One could make transgenic flies that contain a series of deletions spanning ALL SEGMENTS of the…
Q: 24-year-old delivery driver is involved in an accident and sustains a wide abrasion over his left…
A: The objective of the question is to identify the mechanism that allows for the restoration of the…
Q: Which of the below pedigrees best depicts the inheritance pattern of sickle cell anemia? Explain…
A: Sickle cell anemia-It is an autosomal recessive disorder. If both alleles are mutant, then it would…
Q: Tropism refers to the spectrum of tissues infected by a virus. Which parameter can influence viral…
A: The objective of the question is to identify the factors that can influence viral tropism, which is…
Q: NE The black line drawn across this photomicrograph of a seminiferous tubule represents the line of…
A: The question is asking us to identify the line of demarcation in a seminiferous tubule, which is a…
Q: A pathologist uses monoclonal antibodies against several intermediate filament proteins and finds…
A: The objective of the question is to identify the tissue of origin of a tumor based on the presence…
Q: After some time, you found out that you did not like working in microbiology lab, so you found a job…
A: Upon analyzing the park pond water and considering the dogs' illnesses, it's plausible that harmful…
Q: A particular deer population has 50 M individuals, 30 MN individuals, and 70 N individuals. What are…
A: The Hardy-Weinberg law states that the allele and genotypic frequencies in a large, randomly mating…
Q: Which of the following sites contains striated muscle that is not under voluntary control? A.…
A: A soft tissue that found in both animals and humans is called muscle. It is made up of actim and…
Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…
A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…
Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…
A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…
Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…
A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…
Q: Exponential population growth occurs when N=K. True False
A: The statement in question is referring to the concept of population growth in biology, specifically…
Q: for the following amino acids below circle the r groups then tell me if they are polar or nonpolar
A: Contain polar side chains.Interact well with water due to the presence of polar groups like hydroxyl…
Q: A gypsy moth population has overtaken a grove of oak trees. The gypsy moths eat the trees, causing…
A: The objective of the question is to identify the type of density-dependent factor that the gypsy…
Q: What is an anticodon and where is it located on the tRNA structure?
A: The anticodon is a distinctive three-nucleotide sequence present on transfer RNA (t RNA) molecules.…
Q: ry A Detail the process of an adaptive immune response, highlighting the key steps involved in the…
A: The immune system produces two primary responses: the immune system's adaptive response, that's is…
Q: Some geneticists, notably Nobel Prize-winner Dr. Herman J. Muller, have proposed that sperm banks…
A: The concept of using sperm banks to choose sperm cells from givers with uncommon qualities like…
Q: Alpha 2 adrenergic receptors play a key role in endogenous pain control circuits and are…
A: The question is asking about the characteristics of alpha 2 adrenergic receptors, which are a type…
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- Mutation #2: • Change the Mutation to RED TACACC TIG GC GACGACT A U GU G G A A C C G C UG CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA mRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTT G G C G A C GACT AUGUG G A A C C G C U G C U G A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: mRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterSources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
- DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
- 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.Bell Ringer for Thursday Original DNA TAC GCG IG C ACG ATG CAG TAGTAC MRNA Protein Mutation 1 DNA TAC GCG TGC ACG ATCCAG TAG TAC MRNA Protein Type of Mutation: Mutation 2 DNA TACGCCG TGC TCG ATG CAG TAG TAC MRNA Protein Type of Mutation: Mutation 3 DNA TAC GCG CTG CA C GAT GCA GTA GTAC MRNA Protein ype of Mutation:Original DNA sequence : T A C A C C T T G G C G A C G A C T Amino acid sequence? Mutated DNA sequence 1: T A C A T C T T G G C G A C G A C T What base has been changed from the original sequence? MRNA sequence? What is the amino acid sequence? What kind of mutation is this? Mutated DNA sequence 2: T A C G A C C T T G G C G A C G A C T What base has been changed from the original sequence? MRNA sequence What is the amino acid sequence? What kind of mutation is this? Mutated DNA sequence 3: T A C A C C T T A G C G A C G A C T What base has been changed from the original sequence? MRNA sequence What is the amino acid sequence? hat kind of mutation is this?