Multiple Answer Question: Which of the following base compositions (shown as %A, %G, %C, %T, %U) islare possible for a single-stranded RNA? CAA-30% G 10%, C- 30%, T 5%, U - 25% OA 20%G- 20%, C 20%, 1. 20% U- 20% OCA-35% G- 10% C- 30% T 0%, U. 25% ODA 35%, G- 35%, C- 15%, T-0%, U 15% DEA 10%, G- 40%, C. 40%, T- 10% U- 0% DEA- 10%, G-40%, C- 40% T-0%, U 10%

Multiple Answer Question: Which of the following base compositions (shown as %A, %G, %C, %T, %U) islare possible for a single-stranded RNA? CAA-30% G 10%, C- 30%, T 5%, U - 25% OA 20%G- 20%, C 20%, 1. 20% U- 20% OCA-35% G- 10% C- 30% T 0%, U. 25% ODA 35%, G- 35%, C- 15%, T-0%, U 15% DEA 10%, G- 40%, C. 40%, T- 10% U- 0% DEA- 10%, G-40%, C- 40% T-0%, U 10%

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

ent id%3_12087988 18step%3Dnull QUESTION 1 If the base sequence of one DNA strand is AATGCAT, what would the complimentary sequence be? 1 points Save Answer O TATCCAC O AATCGAT O TTACGTA O UUAGCAU QUESTION 2 1 points Save Answer Translation occur in the nucleus. O True False
Are both statements true? 1. Heterogeneous RNA is a term that refers to mRNA that has not been processed. 2. If the %A of a bacteria is 20%, the amount of guanine is 30%. Are both statements true? 1. If the %A of a bacteria is 30%, then the % (G+C) of the bacteria is 40% 2. The DNA is plectonemic because one of the strands go in 5' to 3' direction while the other go in the 3 to 5 direction
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
ntrol A option N S X H command C V G B I N M command ? ?? option Name four differences in the structure and location of DNA VS RNA
The reading frame DNA sequence is: The mRNA sequence is: The polypeptide sequence is:
This figure shows a single nucleotide addition. What would happen if three nucleotides were added?
Which of these molecules could be incorporated into a primer during DNA replication? Select all that apply
a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
If a 100 base-pair double-stranded DNA fragment has 40 cytosines, how many adenines does it contain?
What size DNA fragment would be released after very mild digestion of chromatin with micrococcal nuclease? (This would represent a single cut per nucleosome.) 30 bp O 165 bp 146 bp 200 bp