Multiple Answer Question: Which of the following base compositions (shown as %A, %G, %C, %T, %U) islare possible for a single-stranded RNA? CAA-30% G 10%, C- 30%, T 5%, U - 25% OA 20%G- 20%, C 20%, 1. 20% U- 20% OCA-35% G- 10% C- 30% T 0%, U. 25% ODA 35%, G- 35%, C- 15%, T-0%, U 15% DEA 10%, G- 40%, C. 40%, T- 10% U- 0% DEA- 10%, G-40%, C- 40% T-0%, U 10%

Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran plot (as shown), describe this helix with respect to handedness.

Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results. 5 kbp 5 kbp 5 kbp 5 kb +

Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^   Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?