A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.

Please answer the following 4 questions and answer very short and briefly

Agree or Disagree. Read the statement carefully & write your answer on thespace provided._________ 1. Proteins are long chain of amino acids bonded together for specific use and functions_________ 2. Nucleotide are the building blocks of a nucleic acid._________ 3. Thymine replaces Uracil when pairing Adenine in an RNA strand.

Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2. Codon 3. mRNA 4. Ribosome 5. tRNA

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? [Select] • Which position shows the "A" position? [ [Select] • Which end of the RNA is the 5' end? [Select] • Which base of the anticodon "AUC" (shown in the diagram) is the 5' end? [Select] CAG GAUCAUCGUCUAGAUUGCACAAU

Human immunodeficiency virus (HIV), the causative agent of acquired immune deficiency syndrome (AIDS) infects T-helper cells that have the CD4 receptor on their surface: gp120 RNA- Core with protein coat Envelope (a) Structure of HIV Copyright © 2001 Benjamin Cummings, an imprint of Addison Wesley Longman, Inc. Edit View Insert Format Tools Table 12pt Paragraph -Reverse transcriptase enzyme B -Capsomeres of protein coat I U Αν 2 T cell A. As shown in the above diagram, HIV attaches to a susceptible cell by a binding interaction between the gp120 protein on the virus protein and the CD4 and CXCR4 receptors on the surface of the T-helper cell. What will be the next event in the virus life cycle? B. One mechanism for transmission of HIV is direct contact during sexual activity. What is the other common mechanism of transmission? over DNA (b) HIV infecting a T cell with CD4 receptors, and CXCR4 coreceptors which are distributed over the surface of the cell T² v -CD4 receptor -CXCR4…

True or False: Proteins are assembled two or three amino acids at a time during translation

What types of interactions/bonds/forces are polar amino acids able to form when a polypeptide is folded into tertiary and/or quaternary structure? Be as complete as possible in your list!   How many chromosomes do you have in each of your somatic (non-sex) cells? Answer: 46 (can you help explain why that is)

Help me answer this thank you