Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Related questions
Concept explainers
Question
Match the following descriptions with the enzymes involved in
- Adds an RNA primer to begin elongation
- Removes the RNA primer from the beginning of the newly constructed strands
- Splices lagging strand segments
- Cleaves the rung of the DNA double helix ladder
| Description: |
Answer | Answer | Answer | Answer |
| Enzyme: |
Helicase | DNA Polymerase | Primase | DNA Ligase |
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the entire process of DNA replication. Do not miss leading and lagging strands.arrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardIdentify two important enzymes involved in the replication.arrow_forward
- Some Processes Involved in DNA Replication The replication origin is identified. DNA primase builds RNA primer. Okazaki fragments are spliced by DNA ligase. Helicases bind and uncoil the DNA double helix. RNA primer is the starting point for DNA polymerase. DNA replication ends at the telomere where DNA codes for termination. DNA polymerase adds complementary nucleotides in the 5' to 3' direction in short segments called Okazaki fragments. The sequence in which the events numbered above occur during DNA replication of the lagging strand is:arrow_forwardENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCEarrow_forwardIndicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).Translation AnswerTranscription AnswerDNA replication Answerarrow_forward
- A mutation results in the presence of multiple DNA fragments on the newly synthesized DNA strand following DNA replication. Which enzyme has most likely been mutated? O DNA helicase DNA polymerase DNA ligase O DNA primasearrow_forwardThe region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’arrow_forwardThe enzyme required to open up the double stranded DNA during replication andform the replication fork (two single stranded DNA) is called aarrow_forward
- Tabulate SIGNIFICANT differences between prokaryotic and eukaryotic DNA replication. CRITERIA PROKARYOTE EUKARYOTE Initiation Elongation Termination Site of Replication Rate of Replicationarrow_forwardCircle the following elements that are directly involved in DNA replication process DNA helicase RNA primase Sliding clamp DNA polymerase DNA ligasearrow_forwardWhat is the difference between prokaryotic and eukaryotic DNA replication? in 3-4 sentencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education, 
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education