Have a look at the results in this SDS-PAGE gel. A MW ladder is shown. In the "control" lane, a sample of recombinant protein "LBT3" was loaded. Lane A shows proteins that have been prepared from leukocytes from a normal, healthy individual. Lanes B, C, D, E and F show protein prepared from leukocytes from individuals with lymphoma. What is the best explanation for the result shown for patient D? 200 150 100 75 50 37 20 Weight, kDa MW ladder Control A

Have a look at the results in this SDS-PAGE gel. A MW ladder is shown. In the "control" lane, a sample of recombinant protein "LBT3" was loaded. Lane A shows proteins that have been prepared from leukocytes from a normal, healthy individual. Lanes B, C, D, E and F show protein prepared from leukocytes from individuals with lymphoma. What is the best explanation for the result shown for patient D? 200 150 100 75 50 37 20 Weight, kDa MW ladder Control A

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

hypothetically speaking, if a rapid test was being made to detect RSV (RSV antigen), the conjugate pad would contain the anti-RSV antibody conjugated with HRP. The test line would be the anti-RSV antibody. What would be a suitable control antibody to use?
If a student uses a monoclonal antibody to detect a protein using a direct Western-blotting protocol after running an SDS PAGE, the student can detect a 50kd protein. However, if the student tries to use this antibody to immunoprecipitate the 50 kd protein and then Western -blot the immunoprecipitated samples, the student found that there is no band at all at 50kd region in the Western blot. How do you explain these results based on what you know about protein structure and antigen-antibody recognition? (Hint: Western blot analysis explores an SDS-containing buffer, whereas the immunoprecipitation buffer uses a NP40-containing buffer to maintain proteins in their native form).
In ELISPOT Assay, explain the importance of adding stimulus to the 96-well plate during the incubation of Peripheral Blood mononuclear cells
In the experiment summarized below, scientists were examining the presence of specific sequences in individuals with age. In this experiment they extracted DNA from lymphocytes of various aged individuals and measured the length of a TTAGGG (in kb) repeat they found in their genomic DNA (Left Panel). In the right panel, the scientists measured the length of the same repeats in individuals with lymphocyte failure (red dots most severely effected) that have a mutation in a critical enzyme. Answer the following questions in 2-3 sentences each. A. What is the name of the specific sequence the scientists are measuring in the experiment shown below. B. For the individuals with lymphocyte pathology in the right panel, which gene is likely defective that causes the data shown? C. Explain why the length of the repeat sequence decreases with age.
The schematic on the right is for which molecular biology method? What information does this method reveal?
4) Researcher #1 and #2 in your lab each conducted a protein purification. They present you with the following data. The protein-of-interest is indicated by the red arrowhead, and the numbers on top indicate the purification step. Researcher #1 1 2 3 4 SDS-PAGE (Coomassie Stained) Researcher #2 1 2 3 4 5 6 Immunoblot a) Which researcher has more clearly demonstrated purification of the protein-of-interest? Justify your answer. b) What type of chromatography step did researcher #1 most likely conduct in going from step 2➜ 3 based on the gel? Justify your answer.
There are currently 3 types of Covid- 19 vaccinations. What is the best Covid-19 vaccination and why?
A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
How can we easily determine VEGF expression in a western blot experiment? By using fluorescent microscopy to view its transport into the cell By using a primary antibody targeting VEGF By adding purified VEGFR to an SDS polyacrylamide gel By doing a mass spectrometry analysis
In Figure 10-25, why do only plant cells that have T-DNAinserts in their chromosomes grow on the agar plates?Do all of the cells of a transgenic plant grown from oneclump of cells contain T-DNA? Justify your answer
The diagram in the first figure shows simplified versions of the immunoglobulin heavy chain locus, the T-cell receptor b chain locus, and the locus encoding the RAG-1 and RAG-2 recombinases. For the sake of this question, imagine that these diagrams represent all of the gene segments present in the immunoglobulin heavy chain and T-cell receptor b chain locus. You now analyze five individuals, each of which has a single inactivating mutation in a region of one of these three loci. These mutations are each indicated by a red ‘X’ in the second figure, and are numbered 1–5. For each of these inactivating mutations, indicate the alterations and/or defects that would be seen in the repertoire of antigen receptors found in mature B and T cells in that individual. Also, for each mutation, indicate whether the individual would likely show any immunodeficiency, such as a history of recurrent infections.
In Western Blots and ELISAS, the following molecules are used:  Tween-20 SDS Goat anti-rabbit IgG (whole molecule) – HRP Rabbit anti-egg albumin Bovine IgG Rabbit anti-bovine IgG – HRP Egg albumin (globular protein – what is Molecular weight?) Milk protein (globular protein – what is Molecular weight?) TMB Beta-mercaptoethanol Methanol HCl May you explain the reasons why they are used?