In translation of an mRNA into a protein, the first amino acid that is attached to the start codon is which of the following? a. O-formylmethionine b. Serine c. N-formylmethione d. Cysteine
Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…
A: Transcription is the initial stage in gene expression, when information from a gene is used to build…
Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…
A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…
Q: What type of molecule contains the site where amino acids link together to make a polypeptide? a.…
A: Translation is a process of protein synthesis from an mRNA sequence. It occurs in the ribosomal…
Q: A scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…
A: a scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…
Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…
A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…
Q: During translation, the codon in mRNA is actually “read” by a. the A site in the ribosome. b.…
A: The translation is a process of conversion of mRNA into polypeptides and then into proteins. It…
Q: Which of the following describes the interactions between a codon and an anticodon? A. A codon and…
A: Codon is in mRNA (messenger RNA) and anticodon is in tRNA (transfer RNA).
Q: Evaluate the following statements. Which one statement is false?
A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…
Q: The Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of…
A: Eukaryotic mRNA (messenger ribonucleic acid) can have multiple AUG (start codon) sequences on it.…
Q: Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and…
A: To find The process what occurs next once a peptide bond has been formed between the amino acid…
Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…
A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…
Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…
A: Correct answer is option... B. Translation stops and the protein is released
Q: The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino…
A: Translation of messenger ribonucleic acid (mRNA) into amino acid begins at the 5' end and stops at…
Q: What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d.…
A: Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis.
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…
A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…
Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…
A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…
Q: The ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide…
A: Ribosomes are found on Rough endoplasmic reticulum of a cell (in eukaryotes) , which actively…
Q: 5' 3' A B. 4 3 1 2.
A: The Biochemical process by which triplet of codons on mRNA will be translated into the form of amino…
Q: An MRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? O a.5 CTA 3' O b.5 GUA 3
A: Every tRNA contains a trio of bases, called an anticodon, and ties at a space away from the trio to…
Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…
A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…
Q: The fourth codon in an mRNA is GGG, which specifies glycine. If we assume that no amino acids are…
A: Codon refers to a set of three-nucleotide sequences, which codes for a specific amino acid. The…
Q: Which of the following is true about the genetic code? A. A codon is three to six bases long. B.…
A: The DNA (deoxyribonucleic acid) is the genetic material that is inherited from the parents by the…
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: Which of the following statements about mRNA is INCORRECT? A. the sugar moiety of mRNA is D-ribose…
A:
Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…
A:
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…
Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…
A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…
Q: A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene…
A:
Q: Put the events of translation in order. A. Ribosome reads the start codon and initites…
A: Translation is the process of peptide synthesis in any living organism. It involves the ribosome…
Q: Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single…
A: The RNA or ribonucleic acid is a nucleic acid polymer that it is produced from the DNA by the…
Q: The ribosome is needed for translation of mRNA
A: Protein synthesis is a fundamental molecular phenomenon that takes place in the cytosol. It occurs…
Q: The formation of peptide bonds between amino acids occurs _____. a. during transcription b.…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: Which of the following steps in protein synthesis does not require a direct supply of energy? a.…
A: Protein synthesis inside the cytoplasm is known as translation. Translation process inside the cell…
Q: The amino acid pool used in translation is found in: a. the cytosol b. in the Golgi apparatus c. in…
A: The amino acid pool used in translation.
Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…
A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…
Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…
A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…
Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…
A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…
Q: In the image below, what is the C label pointing to?
A: The above image represents transcription where the RNA polymerase move along the DNA and make the…
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: The genetic code is said to be degenerate, which means that: A An anticodon can interact with more…
A: There are only 20 essential amino acids that needs to be synthesized during formation of a…
Q: The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found…
A:
Q: A codon is: a. a series of consecutive genes b. three nucleotides that specify an amino acid C. the…
A: Given: A codon is.
Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to: A. An amino…
A: The process of protein synthesis is also known as translation. It is possible with the help of…
Q: When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…
A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAA small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.Below is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'
- Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'What term is used to describe the sequence on the tRNA that is complementary to mRNA? Complementary sequence Codon Anti-codon Anti-anticodonAn mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
- A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…Phosphorylation is a very common post-translational modication (PTM) to regulate protein function. Which amino acids are most commonly regulated by phosphorylation? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a Leucine, arginine, serine. b Tyrosine, arginine, glutamine. C Serine, threonine, tyrosine. d Glutamine, arginine, tyrosine. e Serine, tyrosine, glutamine.
- Amino acids are translated from mRNA codons and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into the second codon of a coding sequence of a gene affect the amino acid sequence of the protein encoded by the gene? (Hint: You may want to write out a made-up example of an insertion like the one described above) The entire amino acid sequence would shift and be changed. O A single amino acid would change only. O The mutation may have no effect on the amino acid sequence. O A single extra amino acid would be present in the protein. O All of the above are possible outcomes.What happens when a stop codon is reached by a ribosome? A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome dissociates. A separate peptidyl transferase then releases the protein from tRNAter. A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome is signaled to release the protein. The ribosome then is likely to dissociate. A release factor binds to the codon and is used to release the growing peptide from the P site tRNA. A termination tRNAter binds to the codon and is used to release the growing peptide from the P site tRNA. The ribosome then is likely to dissociate.Which of the following statements concerning translation is NOT correct? O b. O c. Polypeptide chain is extended from the C- terminus to the N-terminus. O d. The first codon of protein synthesis is AUG. Prokaryotic transcription and translation are coupled (i.e. they occur almost at the same time and at the same place). O e. Protein synthesis takes place in ribosome. During protein synthesis, the mRNA is read from 5' to 3' direction.