In relation to DNA Isolation experiment 1. Once the tissue has been ground and heated to 60°C, the DNA is released into the solution, but so are many other types of cellular molecules. List some types of molecules besides DNA that you would expect to find in a cell. 2. What is the role of the detergent in this protocol? How does it perform this function? 3. Name two important functions of the proteases? 4. If you wanted to isolate a copy of the gene that codes for a protein found in the skin, could that gene be located in liver cells? Explain your reasoning 5. What do you think will be the first step in purifying DNA from intact isolated cells? 6. What happened to the other macromolecules once the DNA was precipitated out of solution?

Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب

In bacterial transformation ... 1, Why do you have to incubate the competent bacterial cells on ice after the addition of plasmid DNA? 2. Why do you have to add SOC (Super Optimal Broth with Catabolite repression) medium to bacterial cells? 3. Why do you have to incubate the bacterial cells in SOC medium at 37oC for 45 minutes?

C X DNA and Protein Synthesis Retake Test Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted? What amino acid sequence would be coded for with this mutation? What would be the affect of this mutation on the organism?: DNA AAT СТА GTA MRNA UUA GAU CAU Amino acid Leu Asp His :: frame shift mutation :: no affect on organism :: affect on organism : Leu - Asp - His : point mutation : Leu - Asp - Asp : Stop - lle - ? :: Tyr - Met -? 18 19 20 21 22 23 24 25.

5. The proteins listed below are separated by (1) isoelectric focusing (IEF) followed by (2) sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). A single sample of the protein mixture is placed at the top center of the gel to begin step 1. ID 1 2 3 4 5 6 7 8 Protein Collagen y-Globulin Insulin Fibronectin Lysozyme Pepsin Serum Albumin Myoglobin Molecular Weight 300,000 150,000 5,700 220,000 14,300 34,500 66,500 16,700 Conc pl 0.5 mg/L 4.7 1 mg/L 7.2 12 mg/L 5.3 5.8 11.0 5 mg/L 2 mg/L 10 mg/L - added prior to running IEF? left out of the process entirely? 4 mg/L 2 mg/L 1.0 4.9 7.1 A. Which of these proteins would electrophoresis NOT separate effectively? B. Which of these proteins would isoelectric focusing NOT separate effectively? Type fibrous a-helices globular protein globular protein fibrous protein enzyme digestive enzyme blood protein muscle protein C. Show the expected results after each step, by drawing qualitative diagrams similar to those shown in the class…

Please asap

In size exclusion chromatography, which component will elute last in the set up? O Small proteins will elute last because they do not pass through the pores of the gel beads. O Large proteins will elute last because they pass through the pores of the gel beads. O Small proteins will elute last because they pass through the pores of the gel beads. Large proteins will elute last because they do not pass through the pores of the gel beads.

Matching type Choices are in the picture 6. RF1 and RF2 recognize the three bases to terminate the process 7. CAAT box is found 80 nucleotides from the actual site 8. rho factor and sequence of uracil in a loop conclude the process 9. sigma factor binds to RNA polymerase in the promoter region  10. methionine is removed

DNA EXTRACTION Why do scientists isolate DNA?                                                                                                                    From what part of the subject’s body were cells collected? Give the specific purpose of each experimental step:           Lysis solution & heat:                                                                                             Salt & centrifugation:                                                                                  After centrifuging, where in the tube is the DNA? What is the purpose of adding alcohol?