In relation to DNA Isolation experiment1. Once the tissue has been ground and heated to 60°C, the DNA is released into thesolution, but so are many other types of cellular molecules. List some types ofmolecules besides DNA that you would expect to find in a cell.2. What is the role of the detergent in this protocol? How does it perform this function?3. Name two important functions of the proteases?4. If you wanted to isolate a copy of the gene that codes for a protein found in the skin,could that gene be located in liver cells? Explain your reasoning5. What do you think will be the first step in purifying DNA from intact isolated cells?6. What happened to the other macromolecules once the DNA was precipitated out ofsolution?

Introduction :- Proteases are enzymes that break down proteins by hydrolyzing peptide bonds between…

Answered: In relation to DNA Isolation experiment…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 2QP

See similar textbooks

Similar questions

1. In Gel filtration chromatography, when will you stop collecting eluents if sample is not colored? 2. How does SDS-PAGE separate proteins and peptides from each other? Explain. 3. Explain the Donnan Membrane Phenomenon. Why is it important for the homeostasis of the cell?
typical lab bacterial species that grows at 37°C. Explain your reasoning. 13. One strand of DNA reads as follows: 5'-ATG GCG CGA CTG ACT-3' A. How many nucleotides are listed here? B. What are the three structural components of one nucleotide? C. Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5' and which end is 3'.
1. What is similar and what is different between the following chromatographic methods: Size Exclusion Chromatography; lon Exchange Chromatography; and Affinity Chromatography? This question requires you to compare, rather than simply describe the specified techniques. 2. What is similar and what is different between 1D (one-dimensional) and 2D (two-dimensional) protein gel electrophoresis? This question requires you to compare, rather than simply describe the specified techniques.
Activity 2. Think Like a Scientist Answer the following scenario like you are the experts in the field of genetic engineering. Write your answers below. A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood- clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
TRUE OR FALSE 1. The RNA molecules could be found in the nucleoplasm 2. The cyclobutane pyrimidine dimers are associated with CG to AT mutations 3. The nucleotides are joined by phosphodiester bonds 4. The mRNA carries the amino acids for elongation in protein synthesis 5. The DNA is present in the mitochondria 6. A blue coloration in Bial’s test indicates the presence of pentoses 7. Sodium hydroxide is the hydrolyzing agent in ammonium molybdate test 8. A black precipitate forms when a purine reacts with silver ions 9. Hydrolysis is the breaking of a bond in a molecule using water 10. The phosphate backbone is the site of cleavage during the DNA hydrolysis
Make your DNA extraction buffer. Add 2 teaspoons of detergent, 1 teaspoon of salt, and ½ cup of water to one of the plastic cups. Stir well. 4 Open the bag of fruit and add 2 teaspoons of your DNA extraction buffer. What are cell membranes made of? Which parts are hydrophobic and which are hydrophilic? What does soap do to cell membranes? Why would this be helpful in extracting DNA? What function does the salt perform in the solution?
5. The proteins listed below are separated by (1) isoelectric focusing (IEF) followed by (2) sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). A single sample of the protein mixture is placed at the top center of the gel to begin step 1. ID 1 2 3 4 5 6 7 8 Protein Collagen y-Globulin Insulin Fibronectin Lysozyme Pepsin Serum Albumin Myoglobin Molecular Weight 300,000 150,000 5,700 220,000 14,300 34,500 66,500 16,700 Conc pl 0.5 mg/L 4.7 1 mg/L 7.2 12 mg/L 5.3 5.8 11.0 5 mg/L 2 mg/L 10 mg/L - added prior to running IEF? left out of the process entirely? 4 mg/L 2 mg/L 1.0 4.9 7.1 A. Which of these proteins would electrophoresis NOT separate effectively? B. Which of these proteins would isoelectric focusing NOT separate effectively? Type fibrous a-helices globular protein globular protein fibrous protein enzyme digestive enzyme blood protein muscle protein C. Show the expected results after each step, by drawing qualitative diagrams similar to those shown in the class…
Are both statements true? 1. Heterogeneous RNA is a term that refers to mRNA that has not been processed. 2. If the %A of a bacteria is 20%, the amount of guanine is 30%. Are both statements true? 1. If the %A of a bacteria is 30%, then the % (G+C) of the bacteria is 40% 2. The DNA is plectonemic because one of the strands go in 5' to 3' direction while the other go in the 3 to 5 direction
1. Which protein and nucleic acid molecules are present in the PDB structure with code IKX3? Histones 2A and 2B and DNA only. DNA only. Histones 3 and 4 and DNA only. Histones 2A, 2B, 3, 4 and DNA. DNA ligase. 1. 2. 3. 4. 5. Which amino acids would you expect to find buried in the interior of peripheral membrane protein? 1. leucine, methionine 2. threonine, glutamate tyrosine cysteine 3. 4. 5. lysine, arginine histidine, glutamic acid A basic leucine zipper 1. 3 is the name of a full transcription factor protein. interacts with RNA polymerase. is a portion of a full transcription factor protein. is used to join any type of protein domains. cause aggregation of transcription factors. 4 DNA methylation acts to inhibit gene expression by 1. altering the DNA structure and interfering with proteins that bind. changing binding of histones to DNA. 3. activating the binding of bromodomain containing proteins. 4. 2. forming acetyl groups. changing the TATA box sequence. 5. A-2345 2.
A good way to increase total proteome coverage without using 2D PAGE is to: "Use two, orthogonal types of chromatography" Enrich for phosphopeptides only Analyze whole proteins instead of proteolytic peptides.
True or false? the buffer used during for transferring proteinsto nitrocellulose contains methanol. Transfection is a process for adding proteins directly to cellls. H2B is a type of histone.
Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning