In lab 6, you will set up a PCR reaction to yield amplified DNA products of the rpo B(RNA polymerase B) and 16s rRNA genes. In lab 7, you will set up a sequencing reaction using about 40 ng of these PCR products that you will then add a sequencing primer to the sequencing reaction. If a sequencing reaction is set up with a 100-fold excess of primer to the PCR-amplified DNA product you want to sequence, calculate the number of sequencing primers you will need to add to this sequencing reaction. To perform this calculation, assume your 40 ng sample of double stranded DNA is 4,000 base-pairs (bp) long. Using these two variables of your PCR product [length (in bp) and amount (in g, grams)], you can calculate the number of DNA molecules being sequenced with two conversion factors using the formula below: The average weight of 1 bp is approximately ~650 (g/mole)/bp Avogadro’s number which is 6.02 X 1023 molecules/mole The easiest way to solve this problem is to figure out how much one molecule of DNA would weigh. Then take your 40 ng sample of DNA and divide it by the mass/molecule and then multiply by 100 (excess primer).

In lab 6, you will set up a PCR reaction to yield amplified DNA products of the rpo B(RNA polymerase B) and 16s rRNA genes. In lab 7, you will set up a sequencing reaction using about 40 ng of these PCR products that you will then add a sequencing primer to the sequencing reaction. If a sequencing reaction is set up with a 100-fold excess of primer to the PCR-amplified DNA product you want to sequence, calculate the number of sequencing primers you will need to add to this sequencing reaction. To perform this calculation, assume your 40 ng sample of double stranded DNA is 4,000 base-pairs (bp) long. Using these two variables of your PCR product [length (in bp) and amount (in g, grams)], you can calculate the number of DNA molecules being sequenced with two conversion factors using the formula below: The average weight of 1 bp is approximately ~650 (g/mole)/bp Avogadro’s number which is 6.02 X 1023 molecules/mole The easiest way to solve this problem is to figure out how much one molecule of DNA would weigh. Then take your 40 ng sample of DNA and divide it by the mass/molecule and then multiply by 100 (excess primer).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer
TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?
3 Step3: After you have prepared the 3 diluted plasmid samples and the master mix, you can now use them to prepare the individual PCR reactions. For example, to prepare 25 μl PCR reactions for sample A, you need to combine, J ul of "diluted plasmid sample A", and M ul of "master mix". Repeat this step for all 3 reactions, then you can start the PCR reaction in the thermocycler. Solve for J and M.
#3) Ligase catalyzes a reaction between the 5' phosphate and the 3' hydroxyl groups at the end of DNA molecules. The enzyme calf intestinal phosphatase catalyzes the removal of the 5' phosphate from DNA molecules. What would be the consequence of treating a cloning vector, before ligation, with calf intestinal phosphatase?
show your rationale How many RT-PCR products generated from 13 copies of mRNA (= cDNA) from 33 PCR amplification cycles? What was the original starting number of mRNA molecules if after 36 PCR cycles, the reaction had generated 996,432,412,672 copies?
Q11) Explain, using the pCR 2.1 vector, what we would see if we try to grow cells on a plate with ampicillin and Xgal in each of these scenarios:a) transformation not successful (meaning the plasmid did not go inside the bacteria)b) transformation was successful, but no insert in LacZ gene (plasmid went in the bacteria but there was no inserted DNA in the LacZ gene of the plasmid)c) transformation and the ligation reactions were successful (got the plasmid in, and the plasmid is carrying extra DNA in the LacZ region, yay)
. You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will be used to accomplish the task? Discuss role of each enzyme used for cloning a gene in step wise order.
Need help, please. 1) Which primer could be used as the forward primer, for synthesizing DNA from left to right in the above diagram? Enter the number of the primer here: 2) Which primer could be used as the reverse primer, for synthesizing DNA from right to left in the above diagram? Enter the number of the primer here: 3) Will these primers be part of the final PCR product? a.No, neither primer will be incorporated into the PCR product. b.The forward primer but not the reverse primer will be incorporated into the PCR product. c.The reverse primer but not the forward primer will be incorporated into the PCR product. d.Yes, both primers will be incorporated into the PCR product.
. In the PCR process, if we assume that each cycle takes5 minutes, how manyfold amplification would be accomplished in 1 hour?
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Q 1. Download and read the attached review article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC342244/pdf/nar00470-0155.pdf titled: MspI, an isoschizomer of HpalI which cleaves both unmethylated and methylated Hpall sites and answer the following question: Restriction enzymes have many applications from gene cloning to gene activity and mapping. Use the two above mentioned restriction enzymes to study transcriptional silencing (consider Southern blot method for your example)
The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?