ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of B-galactosidase protein activity with and without lactose present, why?
Q: Assuming that the level of glucose is low, a mutation in the repressor associated with the lac…
A: The lac operon stands for lactose operon. These are a set of genes that are found in E.coli and…
Q: Name and describe two types of constitutive mutants of the lactose operon.
A: Operon can be defined as an operating unit, which is nothing but gene clusters that are located…
Q: Which option is true when considering the regulation of cAMP and the Lac operon. If bacteria are in…
A: Introduction: An operon is a coordinated unit of genetic expression in a bacteria. Jacob and Monod…
Q: Based on your knowledge of allosteric regulation, invent and describe a hypothetical mutation that…
A: The system that controls the metabolism of lactose as the only carbon source is known as the lac…
Q: The trp operon, found in E. coli, is a group of genes that encode biosynthetic enzymes for the amino…
A: When tryptophan levels are low tryptophan operon is induced to transcribe structural genes so that…
Q: 1. Complete the following table based on your lac operon simulations. Absence of lactose Presence of…
A: An operon is a group of genes that are transcribed at the same time. The lac operon consists of…
Q: Explain why (a) inactivation of the O2 or O3 sequence of the lac operon causes only a twofold loss…
A: An operon is defined as a group of genes that have a common promoter and regulator and also…
Q: 1. Explain why catabolite repression is used in regulating the lac operon and describe how it…
A: Repression by glucose of beta-galactosidase synthesis is spontaneously reversible in all strains of…
Q: what is an attenuator? (in context of a prokaryotic operon )
A: Operons are prokaryotic arrangements of multiple genes under the control of a single promoter. The…
Q: Suppose that E. coli sustains a mutation in its gene for the lac operon repressor making the…
A: The lactose operon or lac operon is an inducible operon system under dual – positive and negative…
Q: For the given genotypes (associated with the lac operon in E. coli), indicate with a "+" or "-"…
A: The lactose operon is an example of inducible operon in which the presence of lactose is responsible…
Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?
A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…
Q: 4a. The diagram below represents (a) the lac operon in the OFF state and (b) lac operon in the ON…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: Describe the binding of RNA polymerase, repressors, andactivators to the lac operon when both…
A: The lac operon is a group of genes which has a single promoter and the genes in this operon codes…
Q: The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a…
A: 1) Allolactose inhibits the repressor, allowing the RNA polymerase to bind to the promoter and…
Q: 1 Given the following genotypes, explain how the mutation (identified by a () superscript will…
A: Operon is a unit consisting of one or more systems that function coordinately under the control of…
Q: 1. A. A mutation in E. coli is found that fails to induce the arabinose operon. Upon further…
A: A mutation is a change to the DNA sequence of a cell. This change can be due to rearrangements on…
Q: 4b. Briefly describe the changes in gene expression that happen in the lac operon when lactose is…
A: 4b- lac operon: - Inducible system. - Both positive and negative regulation. - Involved in lactose…
Q: A strain of E. coli has the genotypes shown below at the lac operon, where I = regulator gene, P =…
A: Escherichia coli, is a gram negative bacteria thrives in intestine of all animals which are warm…
Q: I. In the lac operon, repression occurs when there is no lactose present. II. In the absence of…
A: When lactose absent and glucose is present no transcription of lac operon happens. Becaise lac…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction :- Inactivating mutations, also known as loss-of-function mutations, cause the gene…
Q: 5a. The table below summarizes expression of B-galactosidase (lacZ) and permease (lacY) from the lac…
A: 5a) Lac operon is an inducible operon that is expressed in the presence of a substance termed…
Q: If glucose is not available and lactose is absent from the environment, what is the status of…
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: Describe a bacterial operon's structural advantage.
A: *NOTE: Kindly repost for other question. Dear Student as per the guidelines we are supposed to…
Q: High levels of transcription of the lactose operon require all of the following, EXCEPT: A) O the…
A: Lac operon is a gene regulatory mechanism associated with bacterial species while using lactose for…
Q: 5. Briefly describe the lac operon and how it controls the metabolism of lactose.
A: An operon is a group of genes that are expressed under the same regulatory sequences.
Q: Why it is essential to the positive stimulation of transcription of the lac operon ?
A: Lac operon includes the genes that code for the enzymes involved in lactose catabolism.
Q: Discuss the concept of an operon and the roles of the various components in the E. coli lac operon.
A: Escherichia coli is referred to as a gram-negative, rod-shaped, facultative anaerobic, and coliform…
Q: Give all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and…
A: An operon is defined as a group of genes that have a common promoter and regulator and also…
Q: IPTG Absent IPTG Present B-Galactosidase Permease B- Permease Galactoßsidase + O+ z+ Y+ + IS ot z+…
A: Lac operon is the segment of DNA which consists of regulatory gene (I), promoter gene (P), operator…
Q: F’ lac I- O+ Z+/ lac I+ Oc Z- the genotype indicated would lead to what type of expression of…
A: Bacteria contain multicistronic arrangements for the expression of genes that are involved in a…
Q: A)Explain the mechanism by which the lac operon is sensitive to glucose levels (presence and absence…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 4. A mutant strain of E. coli produces B-galactosidase in the presence and the absence of lactose.…
A: An operon is defined as a set of structural genes regulated by a common promoter in bacteria.
Q: By using separate labelled diagrams, describe as detail as possile the actions of the normal and…
A: Lac operon is an inducible type of operon that gets activated when there is no glucose available and…
Q: The lac operon consists of regulatory regions such as the promoter as well as the structural genes…
A: Lac operon is an inducible type of operon system takes place in prokaryotes like E.coli in which…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: 7. If a researcher moves the promoter for the lac operon to the region between the beta…
A: Lac operon is a bacterial gene and it works through a repression mechanism. lac I produces repressor…
Q: Predict the level of genetic activity of the lac operon as well as the status of the lac repressor…
A: Operon acts as a single regulated unit having one or more structural genes, a promoter gene, a…
Q: In the topic about prokaryotic gene expression regulation, we learned about the LacI-, LacIS, and…
A: The mutation is considered as a way in which there is the occurrence of diversity in genes. The…
Q: 1c In context with transcription of prokaryotic genes briefly describe the effect the lac…
A: Transcription within the prokaryotic cell is regulated by the complicated interactions of…
Q: Predict the level of gene expression of the lac operon, as well as the status of the lac represso…
A: Operon functions as a single regulated unit composed of one or more structural genes, a promoter…
Q: 2. Assume you have identified a new operon in bacteria (which you call the suc operon) that encodes…
A: Gene expression in prokaryotes is under the control of an operon system in which the transcription…
Q: Decide which operon each of the following characteristics applies to. Note: a description may apply…
A: Introduction "In E.coli And Other Bacteria, The Lac Operon Is An Operon Or A Set Of Genes With A…
Q: 1. Suppose there was a mutation in the inducer of the lac operon, such that the inducer was unable…
A: Answer : The lac operon will not reveal its element and remains closed. In the lac operon, the…
Q: 1) A. What is the difference between a repressible vs, an inducible operon? B. Using diagrams…
A: The answer is given below
Q: Which statement does NOT explain why the lac operon would not be effectively regulated by an…
A: Lac operon is composed of a regulatory gene, promoter, operator, and structural genes. Lac operon is…
Q: A constitutive mutation in the lac operon may be of several types. [Note that constitutive means…
A: A constitutive mutation in the lac operon may be of several types. Here we have to choose two types…
Q: . a. How many ribosomes are required (at a minimum)for the translation of trpE and trpC from a…
A: Trp operon is also called as tryptophan operon, a group of genes that encodes biosynthetic enzymes…
![i.) Fill in the table for each of the E. coli: (0) = No Activity (+)= Basal Activity and (+++) = High Activity
E. coli chromosome
F Plasmid
B-gal activity?
Permease activity?
When
Lactose is
present
When
Lactose is
present
When
When
Glucose is
present
Glucose is
present
+++
+++
a.) I+ P+ O+ Z+ Y+
none
b.) I^[S] P+ O+ Z+ Y+
none
10
0.
c.) I+ P+ O^[c] Z+ Y+
none
+++
+++
+++
+++
d.) I+ P+ O- Z- Y+
0.
none
+++
+++
e.) I+ P+ O+ Z+ Y+
I^[S] P+ O+ Z+ Y+
f.) I[S] P+ O+ Z- Y+
+ P+ O^[c] Z+ Y-
9.) I^[TB] P+ O+ Z+ Y
I+ P+ O^[c] Z- Y+
h.) I+ P+ O^[c] Z+ Y-
I+ P+ O+ Z** Y+
i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+
Z** is a polar mutation
ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it
nonfunctional, how would that affect the level of B-galactosidase protein activity with
and without lactose present, why?](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F489ac520-fb4a-49de-9034-10284a50d879%2Fab02a38a-8247-492d-83f5-ce360876e11a%2Fwwl9ulz_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True FalseLast week in lab you plated various E. coli mutants. This week we will be analyzing those plates. To help interpret those results, predict the growth/color pattern you'd expect for a Lacz- mutant. Table 1: Options are blue or white for NA plates; Table 2: Options are: growth or none for minimal plates). Table 1 [Select] Table 2 [Select] Xgal glucose Xgal + lactose [Select] [Select] Minimal lactose ΝΑ [Select] Xgal + IPTG [Select] maltose > [Sb. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
- b. Neurospora has an arginine amino acid synthesis pathway shown below: ornithine citrulline arginine NH H2N H2N OH H2N HO HO NH2 NH2 ÑH2 Enzyme A Enzyme B Enzyme C ↑ ↑ Gene A Gene B Gene C Suppose I have a neurospora strain that has a mutation such that it will not grow unless I supplement the media (food) with arginine (but not with citrulline or ornithine). What gene is mutated? Explain your reasoning. C. Suppose I take the strain above that only grows with arginine supplements and cross it to a different mutant Neurospora strain that grows with arginine and citrulline supplements but not ornithine supplements. Assming genes A, B and C are unlinked and there is only one mutation per strain: i) What percentage of the progeny will grow on ornithine? ii) What percentage on citrulline? iii) What percentage on arginine? Show your work for i), ii) and iii). |Calculate these for 1 ug of plasmid DNA in a final total volume of 20 ul. All enzymes being used here are at a concentration of 10 U/µL. For double digests, give the appropriate volume for each enzyme and decide which buffer to use. (HINT: look up double digest conditions on the NEB website.) You should always calculate all volumes in advance to ensure the correct working concentrations and so that you can prepare the digests as efficiently as possible. It is a good idea to check off each component as it is added to the microfuge tube. Complete the table below, including the volume of DNA sample(s) you will need for 1 pg of the DNA (from two different methods in Experiment #3) based on the concentration(s) you determined from the OD260 value, which you will restriction digest with each of the restriction enzymes singly and in double digests in Part A. For example, the volume of DNA sample that contains 1 µg DNA for DNA sample from Part A, Experiment 3: OD260 = 0.024, dilution 500x…#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphologyis strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology? Also, describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon and why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?In your laboratory, you have an F− strain of E. coli that is resistantto streptomycin and is unable to metabolize lactose, but it can metabolizeglucose. Therefore, this strain can grow on a medium thatcontains glucose and streptomycin, but it cannot grow on a mediumcontaining lactose. A researcher has sent you two E. colistrains in two separate tubes. One strain, let’s call it strain A, hasan F′ factor (an F prime factor) that carries the genes that are requiredfor lactose metabolism. On its chromosome, it also has thegenes that are required for glucose metabolism. However, it is sensitiveto streptomycin. This strain can grow on a medium containinglactose or glucose, but it cannot grow if streptomycin is addedto the medium. The second strain, let’s call it strain B, is an F−strain. On its chromosome, it has the genes that are required forlactose and glucose metabolism. Strain B is also sensitive to streptomycin.Unfortunately, when strains A and B were sent to you, thelabels had fallen…
- in isolating ribosomes from a yield sample, describe the ideal type of centrifugation for this separation technique based on the following:*Type of Centrifugation* Type of fraction *Give 2 advantages of using this type of centrifuge.*Give 2 disadvantages of using this type of centrifuge.Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they claim it is superior to the TOP10 cells you have been using. But even with a larger culture size, you discover that your protein yield—using the same Ni-NTA column—is quite low. You discover that the novel strain of Escherichia coli generates an unusually high quantity of dicarboxylic acids, a byproduct of the citric acid cycle that is recognized for its ability to function as an all-purpose metal chelator. What do you think the issue is with purifying IMAC protein with this new strain of E. coli?Before JCVI-syn3.0 was produced, what steps were used to create a synthetic Mycoplasma cell? Put the events below into the correct order. Drag and drop the events into the proper sequence from left to right. ▸ View Available Hint(s) First Step Transformed cells are detected by the presence of lacz, which causes them to cleave Xgal and produce a blue color. Yeast is transformed using Mycoplasma mycoides fragments. The synthetic chromosome is transformed into Mycoplasma capricolum. The synthetic Mycoplasma mycoides chromosome is purified. DNA fragments assemble through homologous recombination in yeast. Reset Help Last Step