I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this?A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this? Second mRNA baseCGUGUUUUPhe UCUUUC F Ucc Ser UAC M JUGC (C)UUAUAUTyrCysUse the 3-letter code for amino acids. If astop codon is encountered use the wordUCA (S) UAA Stop UGA StopLeuUUG (L) ucGUAG Stop UGG Trp (W) G"stop", without ".CUUCUCAU THis CGUA set of nucleotides in an original DNAstrand reads: CTA CTC TTTCuc Leu Ccc Pro CACH) CGC AraCCA (P) CAA Gin CGA (R)(Q)CUA(L)CUGCCGCAGCGGAGUTranscribe this short DNA sequence:ACUIleAUUAAUAsnSerCAUCACC Thr AAC (N) AGC (S)(1)ACA M AAA Lys AGA ArgAUAAUG Met (M ACGAAG (K) AGG (R)EstartGUUGCUGAUASP GGUGUC Val GcC Ala GAC (D) GGC Gly(A)(V)GAA Glu l GGA(G)GUAGCAGUGGCGGAG (E) GGGTranslate this short DNA sequence:A mutation occurs such that the sequence now reads: CTA CTT TTTTranscribe this short DNA sequence:First MRNA base (5' end of codon)Third MRNA base (3' end of codon) A mutation occurs such that the sequence now reads: CTA CTT TTTTranscribe this short DNA sequence:Translate this short DNA sequence:What type of point mutation is this?A mutation occurs such that the sequence now reads: CTA GTC TTTTranscribe this short DNA sequence:Translate this short DNA sequence:What type of point mutation is this?%23

Name: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Tr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this?A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)tra

"Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Science

Biology

I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?

I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine
5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
Complete the labels for the following diagram of translation. NOTE: A is the product of this process, B is a protein that recognizes the stop codon, C and D are types of RNA A B C Write your response here... Write your response here... Write your response here... Write your response here...
oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
mRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’