Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation and termination is present with the corresponding enzymes playing their specific part and make sure to make proper labels.
Q: Answer the following questions using your understanding of the Calvin Cycle to make one maltose…
A: Calvin Cycle involves 3 stages:- 1. Carboxylation, it is the process in which atmospheric carbon…
Q: 10ul of the original sample was transferred to 90ul diluent. Then, the mixture was mixed with 100ul…
A: Hemocytometer is blood cell counting device. It is usally cposed of thick glass on which square…
Q: Classical evolutionary theory assumed that change leads to improvement. T or F?
A: Darwin's theory of evolution is the foundation of classical evolutionism. It asserts that culture…
Q: Why do you suppose that the death from lung cancer has increased much more in women than in men over…
A: We are exposed to various forms of pollutants such as tobacco, gas, particles, pollution, and also…
Q: In the phage titer experiment, why did you plate multiple dilutions? a. so that you should have a…
A: Bacteriophage It is a type of virus that infect bacteria.
Q: Do all gram negative organisms grow on EMB? A. no B. yes
A: EMB (Eosin methylene Blue) is a kind of media that is used to differentiate lactose fermenting…
Q: In the initiation of translation, the process always lines up at the start codon. What is the start…
A: Translation refers to the process of polymerization of amino acids to form a polypeptide. The order…
Q: Activity 10 Pathway of a Glucose Molecule as it Travels Through the Human Body STEP COLOUR ORDER…
A: Introduction Passive transport involves the movement of substances( in this case a glucose molecule)…
Q: The population of a small country increases exponentially at a rate of 3% per year. Predict what the…
A: When there is increase in size of population in the proportion of the present size then the growth…
Q: QUESTION 33 The primary xenobiotic degrading genus are: O a. Staphlococcus O b. Streptococcus O c.…
A: Plant elements, pharmaceuticals, pesticides, cosmetics, flavourings, scents, food additives,…
Q: 3. Differentiate the pathology in vonwillebrand's disease from Hemophilia A, B and C.
A: Introduction Bleeding disorders are a range of disorders in which the body's blood clotting process…
Q: A. Explain how respiration takes place in plants in: Roots Leaves Stem
A: Respiration takes place in roots- Roots, the underground part of the plants, absorbs air from the…
Q: G3P or (C,H,O,P) Figure #2: The Calvin Cycle (this represents three turns of the cycle) Answer the…
A: Calvin cycle converts CO2 from the atmosphere to synthesize carbohydrate molecules. The fixation…
Q: 3 S
A: The microscopic structure depicts the tissue sectioning of Rat testis. The Labeling of the diagram…
Q: The pinniped hookworm (Uncinaria lucasi) life cycle that you learned previously involves which types…
A: Uncinaria lucasi It is commonly called the hookworm, and it completes its life cycle in the fur…
Q: (the enitre duration of x(t) is 10 ms), but x(t) is burried under the noise in the recorded signal,…
A: Electrooculography (EOG) is a technique for measuring the corneo-retinal standing potential that…
Q: Summarize the two steps below AND indicate the specific location within a cell where each.…
A: DNA DNA is a long polynucleotide chain containing information about polypeptide chain.
Q: that turns glutamine into
A: Glutamine and arginine are both non essential amino acid. Mutations are abrupt changes in DNA that…
Q: Sediment Stains I. IDENTIFICATION: Identify the correct sediment stains used. Choose the answer…
A: Introduction The Urine Sediment Stain is a commonly used supravital stain containing crystal violet…
Q: Which of the following is not a requirement for a PCR mix? O a. Taq polymerase O b. Excess…
A: Polymerase chain reaction Polymerase chain reaction or PCR , as it is commonly known who invented by…
Q: when the patient does not manifest any sigh of paresthesia after mandibular block we can explain…
A: ANSWER;- d) a and b Explain;- A mandibular nerve block is a methodology to numb the lower jaw…
Q: List any five aspects of the Human Eye that allow it to collect pictures in the actual world.
A: The human eye is a sense organ that responds to visible light and allows humans to use visual data…
Q: What is the differential agent in EMB medium? a. lactose b. glucose c. phenol red
A: EMB stands for Eosin methylene blue media.
Q: Each one gives some basic information and summarizes its main role in translation. mRNA:…
A: Translation takes place in the cytoplasm. It synthesizes proteins.
Q: In which reagent is extracted DNA suspended to put it in solution? A. Sodium citrate saline buffer…
A: In which reagent is extracted DNA suspended to put it in solution? A. Sodium citrate saline…
Q: What percentage of ATP energy is produced when 9.0 moles of glucose react in the citric acid cycle?…
A: * metabolic pathways occur inorder to produce ATP . * The one mole of glucose we take then the…
Q: Name 10 parts of the cell and mark their differences: just mark (/) if present and (X) if absent.…
A: Different types of cell organelles are present in cell.
Q: QUESTION 10 Cystic Fibrosis is caused by a mutation in a protein called? a. Insulin O b. Amyloid O…
A: Cystic fibrosis transmembrane conductance regulator protein is basically formed by the instruction…
Q: What are the advantages of qPCR (RT-PCR) compared to conventional PCR? Choose all that apply a.…
A: Introduction Real-time RT–PCR is a laboratory technique, it is a nuclear-derived method for…
Q: QUESTION 20 The function of DNA polymerase in DNA replication is? O a. To catalyse the addition of…
A: DNA replication occurs in eukaryotic cells during the S (interphase) phase of the cell cycle. This…
Q: A patient with an allergy history : which of the choices below A patient with an allergy history…
A: Four different types of allergic reactions are immediate, cytotoxic, immune-complex mediated and…
Q: Label the frog testis under microscope
A: figure no 1.... 1 ans.. spermatozoa 2 ans.. seminiferous tubules 3 ans.. Germinal epithelium…
Q: limitation of mouth opening After regional bloc the limitation of mouth opening: All choices are not…
A: Limited mouth opening create problem in eating, speech and oral hygiene. This is caused due to…
Q: Discuss the adaptations that plants and protists have evolved to invade and manipulate their hosts.…
A: Introduction A biological defense mechanism is a form of adaptation that promote the survivability…
Q: We talked about what makes an ideal trait for phylogenetic inference. Please match each of the…
A: The method of reconstructing the evolutionary history of related species by grouping them into ever…
Q: 21) The Sliding Filament Theory agrees with which type(s) of muscle contraction produced by a muscle…
A: Sliding filament theory suggests the muscular contraction mechanism. As per this theory, moter…
Q: How many exons has the CFTR gene?
A: Introduction :- The CFTR gene encodes a membrane protein and chloride channel in vertebrates called…
Q: which reasons do the Prarie chicken and snake weed grasshopper population grow
A: Population growth It is a parameter that defines the increase in several organisms (for which the…
Q: Make a physical comparison between hard and spongy bone and describe the properties of both in the…
A: Bones are connective tissues that differ in shapes and functions and they form a skeletal system…
Q: what factors affect the rate of diffusion and how can these be tested?
A: Introduction Diffusion is the transfer of particles or molecules from a highly concentrated area to…
Q: Describe the following pathogenic bacteria: Bacterium 1. Bacillus anthracis 2. Escherichia coli 3.…
A: Bacterium Staining Reaction Morphology Disease(s) 1. B. anthracis Gram staining: positive, large…
Q: What molecule is produced by the chemical packet in the anaerobe jar that is responsible for…
A: Introduction The existence of free oxygen (O2) distinguishes an aerobic environment from an…
Q: What are all the transcription factor proteins that positively regulates odontogenesis in the…
A: Odontogenesis It is a tooth development process. It is a complex process though which the formation…
Q: Based on this AGE profile, which of the following statements is NOT TRUE? M Uncut Ndel Ndel (Pure)…
A: Electrophoresis is a method that uses an electric field to separate macromolecules in a fluid or gel…
Q: QUESTION 13 The corresponding strands of DNA are said to be? O a. Complimentary O b. Oppositely…
A: Watson and crick's model of DNA structure is the most widely accepted model. DNA is the long polymer…
Q: 16. The pyridine nucleotide pool (NADH, NAD) of metabolites is a major regulator of cellular…
A: An autotroph is an organism that synthesizes complex organic compounds such as carbohydrates,…
Q: How important is RNA extraction in the recent pandemic
A: NOTE: Citing external references are not allowed as per our company's honor code. RNA Ribonucleic…
Q: Expound on how a vascular plant's multicellular body is an outcome of long-term evolutionary…
A: Evolutionary developmental biology, is considered a new norm in evolutionary biology. It arose from…
Q: Which statement is true? is it both true? or is it both incorrect? Statement 1: Major…
A: Introduction :- The major histocompatibility complex is a large gene cluster on vertebrate DNA that…
Q: What are the four properties that define a virus? What is a virion?
A: Virus is defined as the infectious microbes which contains genetic material and it is surrounded by…
Create a 75-nitrogenous base long
Step by step
Solved in 2 steps with 1 images
- Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA replication in bacterium Escherichia coli begins at a site in the DNA called At the replication fork, the strand is synthesized continuously while the strand is synthesized discontinuously (in fragments). The new DNA strand, which is synthesized discontinuously, initially consists of short DNA pieces that are called A short RNA primer at the beginning of each of the DNA fragments is synthesized by an enzyme called and this RNA primer is later removed by the enzyme called using its activity. Single-strand breaks (nicks) that are left behind in this process are sealed by the enzyme called A Moving to another question w!l save this resporse Quebon 4 InSelect the CORRECT pairing. DNA polymerase I : links Okazaki fragments together DNA helicase : unwinds both strands of DNA Primase : removes RNA primer DNA ligase : synthesizes DNA primer
- Put a primer on the top and bottom of bubble at origin. Identify 3’ ends. You can use a thicker line or different color. Primers are short (10-12 nucleotides). Draw two primers on lagging strand. Identify 3’ ends. Draw new DNA strands. Identify 3’ ends. New DNA is at least 10x longer than the primer. You don’t have to draw to scale but make it longer. Remember that the new DNA synthesis begins exactly at the 3’ end of the primer. Do not leave a gap (space) between 3’ end of primer and 5’ end of new DNA. Label leading and lagging strands. PRACTICE this with 5’ at top left and 3’ top left. If you can draw these two bubbles you can draw any of the 4 possible replication forks or any straight line section of DNA replication!Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACYou are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exact fragment sizes are not important.
- The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicase, primase, DNA polymerase III, DNA polymerase I and ligase. Also be sure to indicate the 5’ and 3’ ends of all nucleic acid polymers.Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate as the enzyme helicase unwinds them DNA polymerase catalyzes the covalent addition of free nuclectides to the growing new DNA strands The enzyme primase builds ANA primers on the existing DNA strands Two identical doutle helices First Last
- The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer BankShow the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'