Greetings! Provide an illustration and describe the different types of egg as to the distribution of yolk they contain. Give examples of chordates that have the said type of egg. (a) Alecithal, (b) Meiolecithal, (c) Mesolecithal (d) Polylecithal

Greetings! Provide an illustration and describe the different types of egg as to the distribution of yolk they contain. Give examples of chordates that have the said type of egg. (a) Alecithal, (b) Meiolecithal, (c) Mesolecithal (d) Polylecithal

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter28: Invertebrates

Section: Chapter Questions

Problem 28CTQ: Compare the differences in sexual reproduction between Porifera and Cubozoans. How does the...

See similar textbooks

Related questions

Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…

A: Metalloprotein linkages are most likely to be formed between?

Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…

A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…

Q: 23. If the red cockaded woodpecker (Picoides borealis) is unable to eat the southern pine beetle…

A: This is an omnivorous species that feeds on both adults and larvae and eggs of insects. They'll eat…

Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…

A: Kin selection favors the reproductive success of the other relatives even at a cost to the…

Q: 25. Modern agroecosystems differ from natural ecosystems in all of the following ways except: A.…

A: Answer

Q: Identify the different components of the mammalian (human) blood, describe each and give their…

A: The circulatory system is a system that contains the heart, blood vessels, and blood, and blood is…

Q: a catabolic process.

Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…

A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…

Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…

A: As stem cells are the cells which have the ability to divide and can give rise to many different…

Q: QUESTIUN 12 Consider the arrangement of the following four normal chromosomes from some hypothetical…

A: The centromere is involved in an inversion of a chromosomal fragment, and splits happen on both arms…

Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary…

A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…

A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…

Q: Helen is a 62 yo smoker. Her physician has dignified her as having emphysema that has caused her to…

A: Given: Blood pH=7.40 To explain: To explain about pH level of a person and its effects

Q: Explain in 2 or 3 paragraphs- Phenetics vs Cladistics

A: There are few important points that should kept in mind : As we know that classification is the…

Q: Discuss the principles and applications of Matrix-Assisted Laser Desorption/Ionization…

A: Technology is utilized in science, while science is used in technology. Both are vital to our…

Q: In a few short sentences, describe the most widely accepted hypothesis concerning the evolution of…

A: Humans are different from other animals in many characteristics such as walking on two feet…

Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…

A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…

Q: A community-based intervention program for hypertension was undertaken in two communities to compare…

A: Given: Hypertension is a prominent risk factor that poses global burden of diseases. It is most…

Q: 1.Sustaining intense exercise requires ATP. Could a someone with a defective gene for the enzyme…

A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…

Q: Jay has been suffering from diarrhea for the last 3 days what do you think has happened to his…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…

A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…

Q: What is the role of centrosomes during cell division? OA. to form the spindle fibers that attach to…

A: ANSWER;-D) to form the connection between two chromosomes Explain;- A centrosome is a cell structure…

Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…

A: (According to Bartleby guidelines, first three sub parts have been answered. Please post the…

Q: Distinguish between monohybrid, dihybrid and test crosses. Maximum number of characters (including…

A: Difference between monohybrid and Dihybrid test cross are given below -

Q: You measure the effects of a single allele (Y) on fitness in two populations of spiders, Population…

A: Introduction The incidence of a gene variant in a population is represented by the allele frequency.…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Which of the following structures are involved in balance/equilibrium? Select all that apply.…

A: A. Cerebellum controls posture and balance. Semicircular canal, Vestibule and cochlea are part of…

Q: Many fungi are decomposers and degrade organic matter (such as wood and leaf litter). It has become…

A: Fungi are one of the most important organisms on the planet, they act as decomposers of organic…

Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…

A: When the evolution of different organisms or species from a common ancestor is depicted through a…

Q: Whale 100,000 calories 200 kilocalories (kcal) Krill 1,000,000 calories 80 kcal Cellular respiration…

A: The plants and animals produce the organic material which is renewable and it is known as the living…

Q: ength of the double helix

A: Gene: The gene is a sequence of nucleotides in DNA or RNA which encodes the synthesis of a gene…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA contains the genetic information about the characteristics features of te organism present in…

Q: Recommendations for a healthy diet suggest which of the following energy distributions? A.…

A: Introduction Carbohydrates, lipids, and proteins are macronutrients that must be consumed in large…

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: explain the concepts of inflammation

Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…

A: Skin is the outermost protective covering of the body and is the largest organ it is composed of…

Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…

A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…

Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…

A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…

Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…

A: Nucleic acids are essential for all forms of life and are found in all cells. Nucleic acid comes in…

Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…

A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…

Q: II. Problem Solving: Instruction: Using the data on the situation below, compute for the…

A: We are only allowed to do upto three subpart of a question. Please repost the undone question again.…

Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…

A: Albinism is a disorder of autosomal recessive inheritance. Albinism inhibits melanin production,…

Q: with the Lactose negative go to the Serratia liquefaciens? What does Enterobacter aerogenes causes…

A: Answer

Q: Answer in 3-5 sentences. What is the difference between thermoregulation in endothermic animals and…

A: Thermoregulation is process by which mammals maintain body temperature with tightly controlled…

Q: If the molecular weight of E.coli DNA is taken as 2.7x10 and the average molecular weight of any…

A: Note: The Values given in the question may be different as in original question, but concept is…

Q: What type of transporter moves glucose into the cell against its concentration gradient? A. K+ -…

A: Sodium Potassium pump is a very important criteria for the movement of glucose molecules against the…

Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…

A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…

Question

100%

Greetings!

Provide an illustration and describe the different types of egg as to the distribution of yolk they contain. Give examples of chordates that have the said type of egg.

(a) Alecithal, (b) Meiolecithal, (c) Mesolecithal (d) Polylecithal

Thank you very much.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Mature Medusa 1. Look at the life cycle diagram of a jellyfish species on the right. Immature Medusa a) Indicate which type of reproduction (asexual or sexual) takes place at each of the four stages indicated on the diagram. Explain how you can tell. Fertilised Egg 4 1 Blastula b) What are the advantages of having Medusa Planula - Bud Larva both asexual and sexual reproductive capabilities? c) Under which circumstances do many organisms, such as rotifers and single-celled plankton, switch from asexual to sexual 3 Colony Polyp Bud Polyp reproduction? Why? Frustule Bud Frustule Larva
Meroblastic cleavage is typical of embryos formed from _______________ eggs. (a) moderately telolecithal (b) highly telolecithal (c) isolecithal (d) b and c (e) a, b, and c
. Identify the theme or themes exemplified by (a) thesharp quills of a porcupine, (b) the development of amulticellular organism from a single fertilized egg,and (c) a hummingbird using sugar to power its flight.
Which is theextraembryonic membranewhose function is to storenitrogen wastes of theembryo? Is this functionpresent in placentalmammalian embryos?
Q1. How many stages of cleavage can you identify? Q2. What is the adult fate of notochord?
The cortical reaction of sea urchin eggs functionsdirectly in(A) the formation of a fertilization envelope.(B) the production of a fast block to polyspermy.(C) the generation of an electrical impulse bythe egg.(D) the fusion of egg and sperm nuclei
An additional notochord is grafted next to the developing neural tube. Answer the following questions. (a) what new cells would you expect to develop in the region of the neural tube closest to the graft? (b) What is the notochord-derived molecule that is responsible for the effect?
Which of the following is true about Sea urchin blastula formation and fate map? a) ectoderm that develops into the larval skin and neurons, is regularly produced by the vegetal half of the embryo. b) an1 layer generates cells that can enter either the ectodermal or endodermal organs of the larva. c) veg2 layer forms the endoderm, coelom (internal mesodermal body wall), and the non- skeletogenic mesenchyme. d) small micromeres differentiate into the PGCS e) large micromeres differentiate into the secondary mesenchyme cells
Development Label the following embryo development stages and cells:zygote, blastocoel, embryoblasts, blastomeres, morula, biastocyst, zona pellucida, trophohlasts Zuna pelmicida Stage: 3 Zy90+€ trophoblest blastucuel empryoblost Stage: OORa Stage: blaşt oist How does the overall size of the early embryo compare with the size of the zygote? Explain. At which stage of development does the embryo implant in the uterus?
Somites are evidence of (a) a structure from ectoderm, (b) a structure from endoderm, (c) a structure from lateral plate mesoderm, (d) segmentation in the human body.
8. The major event in the embryonic development of animals that results in a layered embryo is called Group of answer choices choanoflagellation transmogrification ecdysis compartmentalization desagellation gastrulation gelatinization cephalization
How many times larger is the human cell comparedto the bacerial cell? please show callculations.